EMAIL THIS PAGE TO A FRIEND

ADAM7

ADAM metallopeptidase domain 7

77 Gene Product Result for
Synonyms: ADAM 7 ADAM-7 EAPI GP-83 GP83
UniProtKB ID: Q9H2U9, A8K8X7, O75959
Gene ID:
Human(8756) Summary: This gene encodes a member of the ADAMs family of zinc proteases. These transmembrane proteins play roles in multiple processes including cell signaling, adhesion and migration. The encoded protein lacks protease activity and may play roles in protein-protein interactions and cell adhesion processes including sperm-egg fusion. Mutations in this gene may be involved in the progression of melanoma. [provided by RefSeq, Oct 2011]
Mouse(11500) a disintegrin and metallopeptidase domain 7
Rat(29641) ADAM metallopeptidase domain 7
naked mole-rat(101703241) ADAM metallopeptidase domain 7
domestic guinea pig(100731902) ADAM metallopeptidase domain 7
sheep(101119797) ADAM metallopeptidase domain 7
Horse(100058838) ADAM metallopeptidase domain 7
domestic cat(101082307) ADAM metallopeptidase domain 7
dog(477379) ADAM metallopeptidase domain 7
cow(529215) ADAM metallopeptidase domain 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003817 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003817 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003817 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092231 MISSION® esiRNA esiRNA human ADAM7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003817 Rosetta Predictions human pricing
NM_020301 Rosetta Predictions rat pricing
NM_007402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131157 predicted 435
2 SASI_Hs01_00131159 predicted 2169
3 SASI_Hs01_00131161 predicted 1958
4 SASI_Hs02_00336360 predicted 996
5 SASI_Hs02_00336361 predicted 211
6 SASI_Hs01_00131163 predicted 1991
7 SASI_Hs01_00131165 predicted 731
8 SASI_Hs01_00131166 predicted 273
9 SASI_Hs02_00336362 predicted 1044
10 SASI_Hs02_00336363 predicted 1053
11 SASI_Hs01_00131158 predicted 1390
12 SASI_Hs01_00131160 predicted 1633
13 SASI_Hs01_00131162 predicted 1658
14 SASI_Hs01_00131164 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058560 predicted 527
2 SASI_Rn02_00262540 predicted 1694
3 SASI_Rn01_00058561 predicted 822
4 SASI_Rn01_00058562 predicted 596
5 SASI_Rn01_00058564 predicted 2219
6 SASI_Rn01_00058565 predicted 1123
7 SASI_Rn01_00058566 predicted 1161
8 SASI_Rn01_00058567 predicted 2123
9 SASI_Rn01_00058568 predicted 985
10 SASI_Rn02_00262541 predicted 1222
11 SASI_Rn01_00058563 predicted 1153
12 SASI_Rn01_00058569 predicted 1996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311519 predicted 584
2 SASI_Mm01_00181605 predicted 371
3 SASI_Mm01_00181606 predicted 1402
4 SASI_Mm02_00311520 predicted 238
5 SASI_Mm01_00181607 predicted 793
6 SASI_Mm02_00311521 predicted 1193
7 SASI_Mm01_00181608 predicted 2087
8 SASI_Mm01_00181609 predicted 2402
9 SASI_Mm01_00181610 predicted 950
10 SASI_Mm01_00181611 predicted 2375
11 SASI_Mm01_00181612 predicted 2350
12 SASI_Mm01_00181613 predicted 1984
13 SASI_Mm01_00181614 predicted 1088
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007402
ADAM7 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007402.1-538s1c1
Sequence:CCGGGCTCTGATAGATGTTGAGAATCTCGAGATTCTCAACATCTATCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007402.1-716s1c1
Sequence:CCGGCCTTGAACATTCATGTGACTTCTCGAGAAGTCACATGAATGTTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007402.1-133s1c1
Sequence:CCGGCGCATCCATGACTCTGACATACTCGAGTATGTCAGAGTCATGGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007402.1-2248s1c1
Sequence:CCGGCCTCACTATATCACACTGAAACTCGAGTTTCAGTGTGATATAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007402.1-2296s1c1
Sequence:CCGGGCAGACCCTAAGCAAACTGATCTCGAGATCAGTTTGCTTAGGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007402
ADAM7 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007402.1-538s1c1
Sequence:CCGGGCTCTGATAGATGTTGAGAATCTCGAGATTCTCAACATCTATCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007402.1-716s1c1
Sequence:CCGGCCTTGAACATTCATGTGACTTCTCGAGAAGTCACATGAATGTTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007402.1-133s1c1
Sequence:CCGGCGCATCCATGACTCTGACATACTCGAGTATGTCAGAGTCATGGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007402.1-2248s1c1
Sequence:CCGGCCTCACTATATCACACTGAAACTCGAGTTTCAGTGTGATATAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007402.1-2296s1c1
Sequence:CCGGGCAGACCCTAAGCAAACTGATCTCGAGATCAGTTTGCTTAGGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007402
ADAM7 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007402.1-538s1c1
Sequence:CCGGGCTCTGATAGATGTTGAGAATCTCGAGATTCTCAACATCTATCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007402.1-716s1c1
Sequence:CCGGCCTTGAACATTCATGTGACTTCTCGAGAAGTCACATGAATGTTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007402.1-133s1c1
Sequence:CCGGCGCATCCATGACTCTGACATACTCGAGTATGTCAGAGTCATGGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007402.1-2248s1c1
Sequence:CCGGCCTCACTATATCACACTGAAACTCGAGTTTCAGTGTGATATAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007402.1-2296s1c1
Sequence:CCGGGCAGACCCTAAGCAAACTGATCTCGAGATCAGTTTGCTTAGGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003817
ADAM7 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003817.1-1016s1c1
Sequence:CCGGGCCCTATTATTCCACCAGTATCTCGAGATACTGGTGGAATAATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003817.1-2058s1c1
Sequence:CCGGGCCTGTGAAGAAACCTTACATCTCGAGATGTAAGGTTTCTTCACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003817.1-1468s1c1
Sequence:CCGGCGGCGAAAGATGAATGTGATTCTCGAGAATCACATTCATCTTTCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003817.1-444s1c1
Sequence:CCGGGCCAGTATCAGTACGTGTAATCTCGAGATTACACGTACTGATACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003817.1-189s1c1
Sequence:CCGGCCTCTGATACAGAAGCGAGATCTCGAGATCTCGCTTCTGTATCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003817.2-598s21c1
Sequence:CCGGTGCCGTATGGTGCCAATTATTCTCGAGAATAATTGGCACCATACGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003817.2-1250s21c1
Sequence:CCGGCCAGTACTTGAAGGATTATAACTCGAGTTATAATCCTTCAAGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003817.2-2159s21c1
Sequence:CCGGTATCGGAGTTCTTATACTATTCTCGAGAATAGTATAAGAACTCCGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003817
ADAM7 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003817.1-1016s1c1
Sequence:CCGGGCCCTATTATTCCACCAGTATCTCGAGATACTGGTGGAATAATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003817.1-2058s1c1
Sequence:CCGGGCCTGTGAAGAAACCTTACATCTCGAGATGTAAGGTTTCTTCACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003817.1-1468s1c1
Sequence:CCGGCGGCGAAAGATGAATGTGATTCTCGAGAATCACATTCATCTTTCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003817.1-444s1c1
Sequence:CCGGGCCAGTATCAGTACGTGTAATCTCGAGATTACACGTACTGATACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003817.1-189s1c1
Sequence:CCGGCCTCTGATACAGAAGCGAGATCTCGAGATCTCGCTTCTGTATCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003817.2-598s21c1
Sequence:CCGGTGCCGTATGGTGCCAATTATTCTCGAGAATAATTGGCACCATACGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003817.2-1250s21c1
Sequence:CCGGCCAGTACTTGAAGGATTATAACTCGAGTTATAATCCTTCAAGTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003817.2-2159s21c1
Sequence:CCGGTATCGGAGTTCTTATACTATTCTCGAGAATAGTATAAGAACTCCGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003817
ADAM7 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003817.1-1016s1c1
Sequence:CCGGGCCCTATTATTCCACCAGTATCTCGAGATACTGGTGGAATAATAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003817.1-2058s1c1
Sequence:CCGGGCCTGTGAAGAAACCTTACATCTCGAGATGTAAGGTTTCTTCACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003817.1-1468s1c1
Sequence:CCGGCGGCGAAAGATGAATGTGATTCTCGAGAATCACATTCATCTTTCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003817.1-444s1c1
Sequence:CCGGGCCAGTATCAGTACGTGTAATCTCGAGATTACACGTACTGATACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003817.1-189s1c1
Sequence:CCGGCCTCTGATACAGAAGCGAGATCTCGAGATCTCGCTTCTGTATCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003817.2-598s21c1
Sequence:CCGGTGCCGTATGGTGCCAATTATTCTCGAGAATAATTGGCACCATACGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003817.2-1250s21c1
Sequence:CCGGCCAGTACTTGAAGGATTATAACTCGAGTTATAATCCTTCAAGTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003817.2-2159s21c1
Sequence:CCGGTATCGGAGTTCTTATACTATTCTCGAGAATAGTATAAGAACTCCGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)