ADAM9

ADAM metallopeptidase domain 9

199 Gene Product Result for

Synonyms: CORD9 MCMP MDC9 Mltng

Species: Human ADAM9(8754), Mouse Adam9(11502), Rat Adam9(290834), Zebrafish adam9(447940), chicken ADAM9(426781), dog ADAM9(475579), domestic cat ADAM9(101084619), Horse ADAM9(100058578), cow ADAM9(281600), naked mole-rat Adam9(101725832), domestic guinea pig Adam9(100727737), sheep ADAM9(101115001)

UniProtKB ID: Q13443, B7ZLN7, Q10718, Q8NFM6

Gene ID:

Human(8754) Summary: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene interacts with SH3 domain-containing proteins, binds mitotic arrest deficient 2 beta protein, and is also involved in TPA-induced ectodomain shedding of membrane-anchored heparin-binding EGF-like growth factor. Several alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2010]

Mouse(11502) a disintegrin and metallopeptidase domain 9 (meltrin gamma)

Rat(290834) ADAM metallopeptidase domain 9

Zebrafish(447940) a disintegrin and metalloproteinase domain 9

chicken(426781) ADAM metallopeptidase domain 9

dog(475579) ADAM metallopeptidase domain 9

domestic cat(101084619) ADAM metallopeptidase domain 9

Horse(100058578) ADAM metallopeptidase domain 9

cow(281600) ADAM metallopeptidase domain 9

naked mole-rat(101725832) ADAM metallopeptidase domain 9

domestic guinea pig(100727737) ADAM metallopeptidase domain 9

sheep(101115001) ADAM metallopeptidase domain 9

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

A6977	Anti-ADAM-9, N-Terminal Active antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution	human	western blot	pricing

A5101	Anti-ADAM-9, Propeptide Domain antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution	rat, pig, human	western blot	pricing

HPA004000	Anti-ADAM9 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunohistochemistry	pricing

SAB2100050	Anti-ADAM9 antibody produced in rabbit affinity isolated antibody	, rat, horse, human, zebrafish, rabbit, mouse, rabbit, guinea pig, canine	western blot	pricing

WH0008754M1	Monoclonal Anti-ADAM9 antibody produced in mouse clone 3E6, purified immunoglobulin, buffered aqueous solution	human	ELISA, western blot	pricing

Zinc Finger Nucleases

Product #	Description	Add to Cart

CKOZFN2178	CompoZr^® Knockout ZFN Kit Human ADAM9 (NM_003816)	pricing

CKOZFN26273	CompoZr^® Knockout ZFN Kit Mouse Adam9 (NM_007404.2)	pricing

CKOZFN50231	CompoZr^® Knockout ZFN Kit Rat Adam9 (NM_001014772)	pricing

CKOZFND2178	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Human ADAM9 (NM_003816)	pricing

CKOZFND26273	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Mouse Adam9 (NM_007404.2)	pricing

CKOZFND50231	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Rat Adam9 (NM_001014772)	pricing

Proteins

Product #	Description	Species	Add to Cart

QPREST26433	SILu^™PrEST ADAM9 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

ELISA

Product #	Description	Species	Add to Cart

RAB0528	Human ADAM9 ELISA Kit for serum, plasma and cell culture supernatants and urine	human	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR10034	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, ADAM9	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_007404	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_007404	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_007404	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing
SHCLNG-NM_003816	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_003816	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_003816	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU020151	MISSION^® esiRNA esiRNA human ADAM9 (esiRNA1)	human	pricing

EMU047891	MISSION^® esiRNA esiRNA targeting mouse Adam9 (esiRNA1)	mouse	pricing

Related Products

Product #	Description	Add to Cart

AB2959	Anti-ADAM 9 Antibody, disintegrin domain Detect ADAM 9 using this Anti-ADAM 9 Antibody, disintegrin domain validated for use in WB.	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_001005845	Rosetta Predictions	human	pricing
NM_003816	Rosetta Predictions	human	pricing
NM_001014772	Rosetta Predictions	rat	pricing
NM_007404	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001005845	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00112373 predicted	1133
2	SASI_Hs01_00112375 predicted	1648
3	SASI_Hs02_00305027 predicted	1482
4	SASI_Hs01_00112377 predicted	1801
5	SASI_Hs01_00112378 predicted	396
6	SASI_Hs01_00112379 predicted	1015
7	SASI_Hs01_00112380 predicted	1435
8	SASI_Hs01_00112381 predicted	712
9	SASI_Hs01_00112382 predicted	800
10	SASI_Hs02_00305028 predicted	1578
11	SASI_Hs01_00112374 predicted	1632
12	SASI_Hs01_00112376 predicted	306

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_003816	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00224626 predicted	1140
2	SASI_Hs01_00224628 predicted	1641
3	SASI_Hs02_00336358 predicted	1479
4	SASI_Hs01_00224630 predicted	1801
5	SASI_Hs01_00224631 predicted	395
6	SASI_Hs01_00224632 predicted	1020
7	SASI_Hs01_00224633 predicted	1444
8	SASI_Hs01_00224634 predicted	710
9	SASI_Hs01_00224635 predicted	808
10	SASI_Hs02_00336359 predicted	1582
11	SASI_Hs01_00224627 predicted	1632
12	SASI_Hs01_00224629 predicted	302

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001014772	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00201852 predicted	609
2	SASI_Rn02_00201853 predicted	817
3	SASI_Rn02_00201854 predicted	430
4	SASI_Rn02_00201855 predicted	1059
5	SASI_Rn02_00201856 predicted	492
6	SASI_Rn02_00201857 predicted	389
7	SASI_Rn02_00201858 predicted	1185
8	SASI_Rn02_00201859 predicted	760
9	SASI_Rn02_00201860 predicted	1941
10	SASI_Rn02_00201861 predicted	1432

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_007404	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm02_00311522 predicted	1163
2	SASI_Mm02_00311523 predicted	970
3	SASI_Mm02_00311524 predicted	771
4	SASI_Mm02_00311525 predicted	871
5	SASI_Mm02_00311526 predicted	899
6	SASI_Mm02_00311527 predicted	2059
7	SASI_Mm02_00311528 predicted	742
8	SASI_Mm02_00311529 predicted	1203
9	SASI_Mm02_00311530 predicted	1455
10	SASI_Mm02_00311531 predicted	583

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_007404 VALIDATED	ADAM9 MISSION shRNA Bacterial Glycerol Stock ADAM metallopeptidase domain 9	Mouse

9 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000031814
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_007404.1-155s1c1
	Sequence:CCGGCCTTGGAGATTAACTAGAGAACTCGAGTTCTCTAGTTAATCTCCAAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031818
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_007404.1-477s1c1
	Sequence:CCGGGCTCACACTTTGAGCACATATCTCGAGATATGTGCTCAAAGTGTGAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031815
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_007404.1-1930s1c1
	Sequence:CCGGCCTGAATTATGACTGTGACATCTCGAGATGTCACAGTCATAATTCAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031816
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_007404.1-1335s1c1
	Sequence:CCGGGCTGTGAAGGAAGCACTTGTACTCGAGTACAAGTGCTTCCTTCACAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031817
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_007404.1-735s1c1
	Sequence:CCGGGCTTAGCAAACTACCTGGATACTCGAGTATCCAGGTAGTTTGCTAAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000323783
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_007404.2-283s21c1
	Sequence:CCGGCCTTGGAGATTAACTAGAGAACTCGAGTTCTCTAGTTAATCTCCAAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000323718
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_007404.2-1463s21c1
	Sequence:CCGGGCTGTGAAGGAAGCACTTGTACTCGAGTACAAGTGCTTCCTTCACAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000323722
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_007404.2-863s21c1
	Sequence:CCGGGCTTAGCAAACTACCTGGATACTCGAGTATCCAGGTAGTTTGCTAAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000323719
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_007404.2-605s21c1
	Sequence:CCGGGCTCACACTTTGAGCACATATCTCGAGATATGTGCTCAAAGTGTGAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_007404 VALIDATED	ADAM9 MISSION shRNA shRNA Plasmid DNA ADAM metallopeptidase domain 9	Mouse

9 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000031814
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_007404.1-155s1c1
	Sequence:CCGGCCTTGGAGATTAACTAGAGAACTCGAGTTCTCTAGTTAATCTCCAAGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031818
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_007404.1-477s1c1
	Sequence:CCGGGCTCACACTTTGAGCACATATCTCGAGATATGTGCTCAAAGTGTGAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031815
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_007404.1-1930s1c1
	Sequence:CCGGCCTGAATTATGACTGTGACATCTCGAGATGTCACAGTCATAATTCAGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031816
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_007404.1-1335s1c1
	Sequence:CCGGGCTGTGAAGGAAGCACTTGTACTCGAGTACAAGTGCTTCCTTCACAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031817
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_007404.1-735s1c1
	Sequence:CCGGGCTTAGCAAACTACCTGGATACTCGAGTATCCAGGTAGTTTGCTAAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000323783
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_007404.2-283s21c1
	Sequence:CCGGCCTTGGAGATTAACTAGAGAACTCGAGTTCTCTAGTTAATCTCCAAGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000323718
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_007404.2-1463s21c1
	Sequence:CCGGGCTGTGAAGGAAGCACTTGTACTCGAGTACAAGTGCTTCCTTCACAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000323722
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_007404.2-863s21c1
	Sequence:CCGGGCTTAGCAAACTACCTGGATACTCGAGTATCCAGGTAGTTTGCTAAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000323719
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_007404.2-605s21c1
	Sequence:CCGGGCTCACACTTTGAGCACATATCTCGAGATATGTGCTCAAAGTGTGAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_007404 VALIDATED	ADAM9 MISSION shRNA Lentiviral Transduction Particles ADAM metallopeptidase domain 9	Mouse

9 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000031814
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.79	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_007404.1-155s1c1
	Sequence:CCGGCCTTGGAGATTAACTAGAGAACTCGAGTTCTCTAGTTAATCTCCAAGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031818
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.86	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_007404.1-477s1c1
	Sequence:CCGGGCTCACACTTTGAGCACATATCTCGAGATATGTGCTCAAAGTGTGAGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031815
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.6	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_007404.1-1930s1c1
	Sequence:CCGGCCTGAATTATGACTGTGACATCTCGAGATGTCACAGTCATAATTCAGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031816
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_007404.1-1335s1c1
	Sequence:CCGGGCTGTGAAGGAAGCACTTGTACTCGAGTACAAGTGCTTCCTTCACAGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031817
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_007404.1-735s1c1
	Sequence:CCGGGCTTAGCAAACTACCTGGATACTCGAGTATCCAGGTAGTTTGCTAAGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000323783
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_007404.2-283s21c1
	Sequence:CCGGCCTTGGAGATTAACTAGAGAACTCGAGTTCTCTAGTTAATCTCCAAGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000323718
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_007404.2-1463s21c1
	Sequence:CCGGGCTGTGAAGGAAGCACTTGTACTCGAGTACAAGTGCTTCCTTCACAGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000323722
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_007404.2-863s21c1
	Sequence:CCGGGCTTAGCAAACTACCTGGATACTCGAGTATCCAGGTAGTTTGCTAAGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000323719
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_007404.2-605s21c1
	Sequence:CCGGGCTCACACTTTGAGCACATATCTCGAGATATGTGCTCAAAGTGTGAGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_003816 VALIDATED	ADAM9 MISSION shRNA Bacterial Glycerol Stock ADAM metallopeptidase domain 9	Human

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000046978
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003816.1-1628s1c1
	Sequence:CCGGGCCAGTATTATGATGCTCAATCTCGAGATTGAGCATCATAATACTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046979
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003816.1-984s1c1
	Sequence:CCGGGCTAGTTCTAAAGAAAGGTTTCTCGAGAAACCTTTCTTTAGAACTAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046980
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003816.1-1592s1c1
	Sequence:CCGGGCCAGAATAACAAAGCCTATTCTCGAGAATAGGCTTTGTTATTCTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046982
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003816.1-2365s1c1
	Sequence:CCGGCCCAGAGAAGTTCCTATATATCTCGAGATATATAGGAACTTCTCTGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046981
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003816.1-568s1c1
	Sequence:CCGGCGAATGGATGATGTCTACAAACTCGAGTTTGTAGACATCATCCATTCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000290529
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003816.2-2365s21c1
	Sequence:CCGGCCCAGAGAAGTTCCTATATATCTCGAGATATATAGGAACTTCTCTGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000290528
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003816.2-1628s21c1
	Sequence:CCGGGCCAGTATTATGATGCTCAATCTCGAGATTGAGCATCATAATACTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000290526
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003816.2-568s21c1
	Sequence:CCGGCGAATGGATGATGTCTACAAACTCGAGTTTGTAGACATCATCCATTCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000290599
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003816.2-1592s21c1
	Sequence:CCGGGCCAGAATAACAAAGCCTATTCTCGAGAATAGGCTTTGTTATTCTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306856
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003816.2-984s21c1
	Sequence:CCGGGCTAGTTCTAAAGAAAGGTTTCTCGAGAAACCTTTCTTTAGAACTAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_003816 VALIDATED	ADAM9 MISSION shRNA shRNA Plasmid DNA ADAM metallopeptidase domain 9	Human

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000046978
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003816.1-1628s1c1
	Sequence:CCGGGCCAGTATTATGATGCTCAATCTCGAGATTGAGCATCATAATACTGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046979
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003816.1-984s1c1
	Sequence:CCGGGCTAGTTCTAAAGAAAGGTTTCTCGAGAAACCTTTCTTTAGAACTAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046980
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003816.1-1592s1c1
	Sequence:CCGGGCCAGAATAACAAAGCCTATTCTCGAGAATAGGCTTTGTTATTCTGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046982
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003816.1-2365s1c1
	Sequence:CCGGCCCAGAGAAGTTCCTATATATCTCGAGATATATAGGAACTTCTCTGGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046981
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003816.1-568s1c1
	Sequence:CCGGCGAATGGATGATGTCTACAAACTCGAGTTTGTAGACATCATCCATTCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000290529
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003816.2-2365s21c1
	Sequence:CCGGCCCAGAGAAGTTCCTATATATCTCGAGATATATAGGAACTTCTCTGGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000290528
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003816.2-1628s21c1
	Sequence:CCGGGCCAGTATTATGATGCTCAATCTCGAGATTGAGCATCATAATACTGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000290526
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003816.2-568s21c1
	Sequence:CCGGCGAATGGATGATGTCTACAAACTCGAGTTTGTAGACATCATCCATTCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000290599
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003816.2-1592s21c1
	Sequence:CCGGGCCAGAATAACAAAGCCTATTCTCGAGAATAGGCTTTGTTATTCTGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306856
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003816.2-984s21c1
	Sequence:CCGGGCTAGTTCTAAAGAAAGGTTTCTCGAGAAACCTTTCTTTAGAACTAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_003816 VALIDATED	ADAM9 MISSION shRNA Lentiviral Transduction Particles ADAM metallopeptidase domain 9	Human

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000046978
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003816.1-1628s1c1
	Sequence:CCGGGCCAGTATTATGATGCTCAATCTCGAGATTGAGCATCATAATACTGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046979
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003816.1-984s1c1
	Sequence:CCGGGCTAGTTCTAAAGAAAGGTTTCTCGAGAAACCTTTCTTTAGAACTAGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046980
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003816.1-1592s1c1
	Sequence:CCGGGCCAGAATAACAAAGCCTATTCTCGAGAATAGGCTTTGTTATTCTGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046982
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003816.1-2365s1c1
	Sequence:CCGGCCCAGAGAAGTTCCTATATATCTCGAGATATATAGGAACTTCTCTGGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000046981
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: A549
	TRC Version: 1	Clone ID:NM_003816.1-568s1c1
	Sequence:CCGGCGAATGGATGATGTCTACAAACTCGAGTTTGTAGACATCATCCATTCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000290529
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003816.2-2365s21c1
	Sequence:CCGGCCCAGAGAAGTTCCTATATATCTCGAGATATATAGGAACTTCTCTGGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000290528
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003816.2-1628s21c1
	Sequence:CCGGGCCAGTATTATGATGCTCAATCTCGAGATTGAGCATCATAATACTGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000290526
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003816.2-568s21c1
	Sequence:CCGGCGAATGGATGATGTCTACAAACTCGAGTTTGTAGACATCATCCATTCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000290599
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.95	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003816.2-1592s21c1
	Sequence:CCGGGCCAGAATAACAAAGCCTATTCTCGAGAATAGGCTTTGTTATTCTGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306856
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_003816.2-984s21c1
	Sequence:CCGGGCTAGTTCTAAAGAAAGGTTTCTCGAGAAACCTTTCTTTAGAACTAGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart