EMAIL THIS PAGE TO A FRIEND

ADAP1

ArfGAP with dual PH domains 1

55 Gene Product Result for
Synonyms: CENTA1 GCS1L p42IP4
UniProtKB ID: O75689, A4D2Q2
Gene ID:
Mouse(231821) ArfGAP with dual PH domains 1
Rat(171097) ArfGAP with dual PH domains 1
chicken(416451) ArfGAP with dual PH domains 1
domestic cat(101088290) ArfGAP with dual PH domains 1
cow(282176) ArfGAP with dual PH domains 1
dog(606942) ArfGAP with dual PH domains 1
naked mole-rat(101702135) ArfGAP with dual PH domains 1
domestic guinea pig(100734535) ArfGAP with dual PH domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006869 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006869 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006869 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172723 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172723 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172723 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006869 Rosetta Predictions human pricing
NM_133567 Rosetta Predictions rat pricing
NM_172723 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147312 predicted 1262
2 SASI_Hs01_00147313 predicted 1330
3 SASI_Hs02_00342504 predicted 899
4 SASI_Hs01_00147314 predicted 1274
5 SASI_Hs01_00147315 predicted 554
6 SASI_Hs02_00342505 predicted 422
7 SASI_Hs01_00147316 predicted 781
8 SASI_Hs01_00147318 predicted 1136
9 SASI_Hs01_00147319 predicted 693
10 SASI_Hs01_00147320 predicted 1317
11 SASI_Hs01_00147317 predicted 1765
12 SASI_Hs01_00147321 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133567 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060782 predicted 528
2 SASI_Rn01_00060783 predicted 325
3 SASI_Rn01_00060784 predicted 284
4 SASI_Rn01_00060785 predicted 515
5 SASI_Rn02_00267758 predicted 578
6 SASI_Rn01_00060786 predicted 1362
7 SASI_Rn01_00060787 predicted 1347
8 SASI_Rn01_00060788 predicted 809
9 SASI_Rn01_00060789 predicted 1340
10 SASI_Rn01_00060790 predicted 596
11 SASI_Rn01_00060791 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344525 predicted 291
2 SASI_Mm01_00195927 predicted 688
3 SASI_Mm01_00195928 predicted 466
4 SASI_Mm01_00195929 predicted 516
5 SASI_Mm01_00195930 predicted 1602
6 SASI_Mm02_00344526 predicted 343
7 SASI_Mm01_00195931 predicted 754
8 SASI_Mm01_00195932 predicted 1362
9 SASI_Mm01_00195933 predicted 897
10 SASI_Mm02_00344527 predicted 523
11 SASI_Mm01_00195934 predicted 290
12 SASI_Mm01_00195935 predicted 701
13 SASI_Mm01_00195936 predicted 380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006869
ADAP1 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with dual PH domains 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006869.2-1321s21c1
Sequence:CCGGACGGACATTGGACTCACTGTGCTCGAGCACAGTGAGTCCAATGTCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006869.2-698s21c1
Sequence:CCGGGATGAAGATCGAGCACCTGAACTCGAGTTCAGGTGCTCGATCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006869.2-512s21c1
Sequence:CCGGGTACGAGCGACAGGAGTTCATCTCGAGATGAACTCCTGTCGCTCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006869.2-309s21c1
Sequence:CCGGTCGGGAATCCACCGGAATATCCTCGAGGATATTCCGGTGGATTCCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006869.1-789s1c1
Sequence:CCGGCAGCACCCGTAACATCTTCATCTCGAGATGAAGATGTTACGGGTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180318    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006869.1-1750s1c1
Sequence:CCGGCCCACCTCCACGACTATTTATCTCGAGATAAATAGTCGTGGAGGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006869.1-1284s1c1
Sequence:CCGGGCACTTCAAGCATAAACCTTACTCGAGTAAGGTTTATGCTTGAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006869.1-655s1c1
Sequence:CCGGGCTCTGAAGTATTTCAACAGACTCGAGTCTGTTGAAATACTTCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006869
ADAP1 MISSION shRNA shRNA Plasmid DNA
ArfGAP with dual PH domains 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006869.2-1321s21c1
Sequence:CCGGACGGACATTGGACTCACTGTGCTCGAGCACAGTGAGTCCAATGTCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006869.2-698s21c1
Sequence:CCGGGATGAAGATCGAGCACCTGAACTCGAGTTCAGGTGCTCGATCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006869.2-512s21c1
Sequence:CCGGGTACGAGCGACAGGAGTTCATCTCGAGATGAACTCCTGTCGCTCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006869.2-309s21c1
Sequence:CCGGTCGGGAATCCACCGGAATATCCTCGAGGATATTCCGGTGGATTCCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006869.1-789s1c1
Sequence:CCGGCAGCACCCGTAACATCTTCATCTCGAGATGAAGATGTTACGGGTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180318    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006869.1-1750s1c1
Sequence:CCGGCCCACCTCCACGACTATTTATCTCGAGATAAATAGTCGTGGAGGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006869.1-1284s1c1
Sequence:CCGGGCACTTCAAGCATAAACCTTACTCGAGTAAGGTTTATGCTTGAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006869.1-655s1c1
Sequence:CCGGGCTCTGAAGTATTTCAACAGACTCGAGTCTGTTGAAATACTTCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006869
ADAP1 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with dual PH domains 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006869.2-1321s21c1
Sequence:CCGGACGGACATTGGACTCACTGTGCTCGAGCACAGTGAGTCCAATGTCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006869.2-698s21c1
Sequence:CCGGGATGAAGATCGAGCACCTGAACTCGAGTTCAGGTGCTCGATCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006869.2-512s21c1
Sequence:CCGGGTACGAGCGACAGGAGTTCATCTCGAGATGAACTCCTGTCGCTCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006869.2-309s21c1
Sequence:CCGGTCGGGAATCCACCGGAATATCCTCGAGGATATTCCGGTGGATTCCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181086    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006869.1-789s1c1
Sequence:CCGGCAGCACCCGTAACATCTTCATCTCGAGATGAAGATGTTACGGGTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180318    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006869.1-1750s1c1
Sequence:CCGGCCCACCTCCACGACTATTTATCTCGAGATAAATAGTCGTGGAGGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006869.1-1284s1c1
Sequence:CCGGGCACTTCAAGCATAAACCTTACTCGAGTAAGGTTTATGCTTGAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006869.1-655s1c1
Sequence:CCGGGCTCTGAAGTATTTCAACAGACTCGAGTCTGTTGAAATACTTCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172723
ADAP1 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with dual PH domains 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172723.1-1457s1c1
Sequence:CCGGCCACCTCAACAAGTATTTATTCTCGAGAATAAATACTTGTTGAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172723.1-334s1c1
Sequence:CCGGGCCCTGAAATACTTCAACAAACTCGAGTTTGTTGAAGTATTTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172723.1-103s1c1
Sequence:CCGGAGAGCCACATTTGAGTCCAAACTCGAGTTTGGACTCAAATGTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172723.1-304s1c1
Sequence:CCGGCGGAAGTTTGTGCTGACAGAACTCGAGTTCTGTCAGCACAAACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172723.1-696s1c1
Sequence:CCGGCCGAAGGCTCATGTACTTCAACTCGAGTTGAAGTACATGAGCCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172723
ADAP1 MISSION shRNA shRNA Plasmid DNA
ArfGAP with dual PH domains 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172723.1-1457s1c1
Sequence:CCGGCCACCTCAACAAGTATTTATTCTCGAGAATAAATACTTGTTGAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172723.1-334s1c1
Sequence:CCGGGCCCTGAAATACTTCAACAAACTCGAGTTTGTTGAAGTATTTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172723.1-103s1c1
Sequence:CCGGAGAGCCACATTTGAGTCCAAACTCGAGTTTGGACTCAAATGTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172723.1-304s1c1
Sequence:CCGGCGGAAGTTTGTGCTGACAGAACTCGAGTTCTGTCAGCACAAACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172723.1-696s1c1
Sequence:CCGGCCGAAGGCTCATGTACTTCAACTCGAGTTGAAGTACATGAGCCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172723
ADAP1 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with dual PH domains 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172723.1-1457s1c1
Sequence:CCGGCCACCTCAACAAGTATTTATTCTCGAGAATAAATACTTGTTGAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172723.1-334s1c1
Sequence:CCGGGCCCTGAAATACTTCAACAAACTCGAGTTTGTTGAAGTATTTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172723.1-103s1c1
Sequence:CCGGAGAGCCACATTTGAGTCCAAACTCGAGTTTGGACTCAAATGTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172723.1-304s1c1
Sequence:CCGGCGGAAGTTTGTGCTGACAGAACTCGAGTTCTGTCAGCACAAACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172723.1-696s1c1
Sequence:CCGGCCGAAGGCTCATGTACTTCAACTCGAGTTGAAGTACATGAGCCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)