EMAIL THIS PAGE TO A FRIEND

ADCK1

aarF domain containing kinase 1

62 Gene Product Result for
UniProtKB ID: Q86TW2, B3KUD5, Q6PD65, Q9UIE6
Gene ID:
Mouse(72113) aarF domain containing kinase 1
Rat(366698) aarF domain containing kinase 1
Zebrafish(100144553) aarF domain containing kinase 1
chicken(423382) aarF domain containing kinase 1
dog(490811) aarF domain containing kinase 1
domestic cat(101086817) aarF domain containing kinase 1
Horse(100052487) aarF domain containing kinase 1
cow(533372) aarF domain containing kinase 1
sheep(101116318) aarF domain containing kinase 1
Domestic Rabbit(100358292) aarF domain containing kinase 1
domestic guinea pig(100728539) aarF domain containing kinase 1
naked mole-rat(101700463) aarF domain containing kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028105 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028105 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028105 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020421 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020421 Rosetta Predictions human pricing
NM_001108985 Rosetta Predictions rat pricing
NM_028105 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053955 predicted 982
2 SASI_Hs01_00053956 predicted 712
3 SASI_Hs01_00053957 predicted 691
4 SASI_Hs01_00053958 predicted 884
5 SASI_Hs01_00053959 predicted 930
6 SASI_Hs01_00053960 predicted 1059
7 SASI_Hs01_00053961 predicted 673
8 SASI_Hs01_00053962 predicted 1060
9 SASI_Hs01_00053963 predicted 1505
10 SASI_Hs01_00053964 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108985 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244034 predicted 934
2 SASI_Rn02_00244035 predicted 859
3 SASI_Rn02_00244036 predicted 348
4 SASI_Rn02_00244037 predicted 479
5 SASI_Rn02_00244038 predicted 1434
6 SASI_Rn02_00244039 predicted 844
7 SASI_Rn02_00244040 predicted 246
8 SASI_Rn02_00244041 predicted 1080
9 SASI_Rn02_00244042 predicted 660
10 SASI_Rn02_00244043 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028105 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077101 predicted 1165
2 SASI_Mm01_00077102 predicted 1156
3 SASI_Mm01_00077103 predicted 362
4 SASI_Mm01_00077104 predicted 1543
5 SASI_Mm01_00077105 predicted 260
6 SASI_Mm01_00077106 predicted 1244
7 SASI_Mm01_00077110 predicted 1401
8 SASI_Mm02_00333347 predicted 1053
9 SASI_Mm02_00333348 predicted 678
10 SASI_Mm02_00333349 predicted 1153
11 SASI_Mm01_00077107 predicted 907
12 SASI_Mm01_00077108 predicted 880
13 SASI_Mm01_00077109 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028105
ADCK1 MISSION shRNA Bacterial Glycerol Stock
aarF domain containing kinase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028105.3-597s21c1
Sequence:CCGGGGGCAAGGAGATCCACGATTTCTCGAGAAATCGTGGATCTCCTTGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028105.3-1389s21c1
Sequence:CCGGGGACTCAGAGATTCGCAATAACTCGAGTTATTGCGAATCTCTGAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028105.3-366s21c1
Sequence:CCGGATATGGCTCTGAGGAGTATTTCTCGAGAAATACTCCTCAGAGCCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028105.3-1950s21c1
Sequence:CCGGGGAGAGTGAGATGGGATAAAGCTCGAGCTTTATCCCATCTCACTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028105.2-1651s1c1
Sequence:CCGGCTGTGGCAGATCAACCTTCATCTCGAGATGAAGGTTGATCTGCCACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028105.2-973s1c1
Sequence:CCGGGAATTTGTAGAGGGAGGTCAACTCGAGTTGACCTCCCTCTACAAATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028105.2-1390s1c1
Sequence:CCGGGACTCAGAGATTCGCAATAATCTCGAGATTATTGCGAATCTCTGAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028105.2-246s1c1
Sequence:CCGGCTACCTCTACAGTAACAACTACTCGAGTAGTTGTTACTGTAGAGGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028105
ADCK1 MISSION shRNA shRNA Plasmid DNA
aarF domain containing kinase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028105.3-597s21c1
Sequence:CCGGGGGCAAGGAGATCCACGATTTCTCGAGAAATCGTGGATCTCCTTGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028105.3-1389s21c1
Sequence:CCGGGGACTCAGAGATTCGCAATAACTCGAGTTATTGCGAATCTCTGAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028105.3-366s21c1
Sequence:CCGGATATGGCTCTGAGGAGTATTTCTCGAGAAATACTCCTCAGAGCCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028105.3-1950s21c1
Sequence:CCGGGGAGAGTGAGATGGGATAAAGCTCGAGCTTTATCCCATCTCACTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028105.2-1651s1c1
Sequence:CCGGCTGTGGCAGATCAACCTTCATCTCGAGATGAAGGTTGATCTGCCACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028105.2-973s1c1
Sequence:CCGGGAATTTGTAGAGGGAGGTCAACTCGAGTTGACCTCCCTCTACAAATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028105.2-1390s1c1
Sequence:CCGGGACTCAGAGATTCGCAATAATCTCGAGATTATTGCGAATCTCTGAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028105.2-246s1c1
Sequence:CCGGCTACCTCTACAGTAACAACTACTCGAGTAGTTGTTACTGTAGAGGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028105
ADCK1 MISSION shRNA Lentiviral Transduction Particles
aarF domain containing kinase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028105.3-597s21c1
Sequence:CCGGGGGCAAGGAGATCCACGATTTCTCGAGAAATCGTGGATCTCCTTGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028105.3-1389s21c1
Sequence:CCGGGGACTCAGAGATTCGCAATAACTCGAGTTATTGCGAATCTCTGAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028105.3-366s21c1
Sequence:CCGGATATGGCTCTGAGGAGTATTTCTCGAGAAATACTCCTCAGAGCCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028105.3-1950s21c1
Sequence:CCGGGGAGAGTGAGATGGGATAAAGCTCGAGCTTTATCCCATCTCACTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028105.2-1651s1c1
Sequence:CCGGCTGTGGCAGATCAACCTTCATCTCGAGATGAAGGTTGATCTGCCACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028105.2-973s1c1
Sequence:CCGGGAATTTGTAGAGGGAGGTCAACTCGAGTTGACCTCCCTCTACAAATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028105.2-1390s1c1
Sequence:CCGGGACTCAGAGATTCGCAATAATCTCGAGATTATTGCGAATCTCTGAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028105.2-246s1c1
Sequence:CCGGCTACCTCTACAGTAACAACTACTCGAGTAGTTGTTACTGTAGAGGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020421
VALIDATED
ADCK1 MISSION shRNA Bacterial Glycerol Stock
aarF domain containing kinase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020421.3-2045s21c1
Sequence:CCGGGCACATGGTCTCTGAATTTGACTCGAGTCAAATTCAGAGACCATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020421.3-1152s21c1
Sequence:CCGGGTCTCTGATCTGGACTGACATCTCGAGATGTCAGTCCAGATCAGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020421.2-1576s1c1
Sequence:CCGGGACCGGGTCTTGGCCCTAATACTCGAGTATTAGGGCCAAGACCCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-190s1c1
Sequence:CCGGGCTGTCATCAGTTACGACTACCTCGAGGTAGTCGTAACTGATGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1104s1c1
Sequence:CCGGGTCTCTGATCTGGACTGACATCTCGAGATGTCAGTCCAGATCAGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199293    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020421.2-2054s1c1
Sequence:CCGGCCAGAGGAAGTCACACCTCAGCTCGAGCTGAGGTGTGACTTCCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1846s1c1
Sequence:CCGGGAAGACTCAGCAGCCTACATTCTCGAGAATGTAGGCTGCTGAGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1997s1c1
Sequence:CCGGGCACATGGTCTCTGAATTTGACTCGAGTCAAATTCAGAGACCATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1250s1c1
Sequence:CCGGCCACTGAGGACTTAGAGATTCCTCGAGGAATCTCTAAGTCCTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1458s1c1
Sequence:CCGGGAAGAAGAATACCTGTTCATTCTCGAGAATGAACAGGTATTCTTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1067s1c1
Sequence:CCGGCGGAAGAATTCCGCCTGAATTCTCGAGAATTCAGGCGGAATTCTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020421.2-477s1c1
Sequence:CCGGCCATGATTTGTTCCAGAGCTTCTCGAGAAGCTCTGGAACAAATCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020421
VALIDATED
ADCK1 MISSION shRNA shRNA Plasmid DNA
aarF domain containing kinase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020421.3-2045s21c1
Sequence:CCGGGCACATGGTCTCTGAATTTGACTCGAGTCAAATTCAGAGACCATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020421.3-1152s21c1
Sequence:CCGGGTCTCTGATCTGGACTGACATCTCGAGATGTCAGTCCAGATCAGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020421.2-1576s1c1
Sequence:CCGGGACCGGGTCTTGGCCCTAATACTCGAGTATTAGGGCCAAGACCCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-190s1c1
Sequence:CCGGGCTGTCATCAGTTACGACTACCTCGAGGTAGTCGTAACTGATGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1104s1c1
Sequence:CCGGGTCTCTGATCTGGACTGACATCTCGAGATGTCAGTCCAGATCAGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199293    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020421.2-2054s1c1
Sequence:CCGGCCAGAGGAAGTCACACCTCAGCTCGAGCTGAGGTGTGACTTCCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1846s1c1
Sequence:CCGGGAAGACTCAGCAGCCTACATTCTCGAGAATGTAGGCTGCTGAGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1997s1c1
Sequence:CCGGGCACATGGTCTCTGAATTTGACTCGAGTCAAATTCAGAGACCATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1250s1c1
Sequence:CCGGCCACTGAGGACTTAGAGATTCCTCGAGGAATCTCTAAGTCCTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1458s1c1
Sequence:CCGGGAAGAAGAATACCTGTTCATTCTCGAGAATGAACAGGTATTCTTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1067s1c1
Sequence:CCGGCGGAAGAATTCCGCCTGAATTCTCGAGAATTCAGGCGGAATTCTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020421.2-477s1c1
Sequence:CCGGCCATGATTTGTTCCAGAGCTTCTCGAGAAGCTCTGGAACAAATCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020421
VALIDATED
ADCK1 MISSION shRNA Lentiviral Transduction Particles
aarF domain containing kinase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020421.3-2045s21c1
Sequence:CCGGGCACATGGTCTCTGAATTTGACTCGAGTCAAATTCAGAGACCATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020421.3-1152s21c1
Sequence:CCGGGTCTCTGATCTGGACTGACATCTCGAGATGTCAGTCCAGATCAGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020421.2-1576s1c1
Sequence:CCGGGACCGGGTCTTGGCCCTAATACTCGAGTATTAGGGCCAAGACCCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-190s1c1
Sequence:CCGGGCTGTCATCAGTTACGACTACCTCGAGGTAGTCGTAACTGATGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1104s1c1
Sequence:CCGGGTCTCTGATCTGGACTGACATCTCGAGATGTCAGTCCAGATCAGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199293    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020421.2-2054s1c1
Sequence:CCGGCCAGAGGAAGTCACACCTCAGCTCGAGCTGAGGTGTGACTTCCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1846s1c1
Sequence:CCGGGAAGACTCAGCAGCCTACATTCTCGAGAATGTAGGCTGCTGAGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196277    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1997s1c1
Sequence:CCGGGCACATGGTCTCTGAATTTGACTCGAGTCAAATTCAGAGACCATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1250s1c1
Sequence:CCGGCCACTGAGGACTTAGAGATTCCTCGAGGAATCTCTAAGTCCTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1458s1c1
Sequence:CCGGGAAGAAGAATACCTGTTCATTCTCGAGAATGAACAGGTATTCTTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020421.2-1067s1c1
Sequence:CCGGCGGAAGAATTCCGCCTGAATTCTCGAGAATTCAGGCGGAATTCTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020421.2-477s1c1
Sequence:CCGGCCATGATTTGTTCCAGAGCTTCTCGAGAAGCTCTGGAACAAATCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)