EMAIL THIS PAGE TO A FRIEND

ADCY9

adenylate cyclase 9

139 Gene Product Result for
Synonyms: AC9
Gene ID:
Human(115) Summary: Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. It is regulated by a family of G protein-coupled receptors, protein kinases, and calcium. The type 9 adenylyl cyclase is a widely distributed adenylyl cyclase, and it is stimulated by beta-adrenergic receptor activation but is insensitive to forskolin, calcium, and somatostatin. [provided by RefSeq, Jul 2008]
Mouse(11515) adenylate cyclase 9
Rat(302950) adenylate cyclase 9
chicken(395339) adenylate cyclase 9
cow(525482) adenylate cyclase 9
Horse(100066046) adenylate cyclase 9
domestic cat(101095942) adenylate cyclase 9
dog(490031) adenylate cyclase 9
sheep(101122401) adenylate cyclase 9
Domestic Rabbit(100340877) adenylate cyclase 9
domestic guinea pig(100717226) adenylate cyclase 9
naked mole-rat(101714605) adenylate cyclase 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
S153 SQ 22,536 ≥97% (HPLC), powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001116 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009624 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009624 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009624 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064941 MISSION® esiRNA esiRNA human ADCY9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001116 Rosetta Predictions human pricing
NM_001106980 Rosetta Predictions rat pricing
NM_009624 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098727 predicted 1667
2 SASI_Hs01_00098728 predicted 2715
3 SASI_Hs01_00098729 predicted 1700
4 SASI_Hs01_00098730 predicted 2775
5 SASI_Hs01_00098731 predicted 4207
6 SASI_Hs01_00098732 predicted 4241
7 SASI_Hs01_00098733 predicted 941
8 SASI_Hs01_00098734 predicted 4522
9 SASI_Hs01_00098735 predicted 1729
10 SASI_Hs02_00326996 predicted 2815
11 SASI_Hs01_00098736 predicted 4652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106980 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224296 predicted 995
2 SASI_Rn02_00224297 predicted 967
3 SASI_Rn02_00224298 predicted 1202
4 SASI_Rn02_00224299 predicted 819
5 SASI_Rn02_00224300 predicted 433
6 SASI_Rn02_00224301 predicted 449
7 SASI_Rn02_00224302 predicted 1245
8 SASI_Rn02_00224303 predicted 1733
9 SASI_Rn02_00224304 predicted 761
10 SASI_Rn02_00224305 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009624 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074440 predicted 636
2 SASI_Mm01_00074441 predicted 3875
3 SASI_Mm01_00074442 predicted 2179
4 SASI_Mm01_00074443 predicted 3995
5 SASI_Mm01_00074445 predicted 4031
6 SASI_Mm01_00074446 predicted 1159
7 SASI_Mm01_00074447 predicted 4152
8 SASI_Mm02_00316575 predicted 2701
9 SASI_Mm02_00316576 predicted 2710
10 SASI_Mm01_00074449 predicted 4176
11 SASI_Mm01_00074444 predicted 2282
12 SASI_Mm01_00074448 predicted 2706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001116
VALIDATED
ADCY9 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001116.2-947s21c1
Sequence:CCGGCCACATGAGATCCAGACTGATCTCGAGATCAGTCTGGATCTCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001116.2-1481s21c1
Sequence:CCGGGCAATCCATTATGCACGGGAACTCGAGTTCCCGTGCATAATGGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001116.2-1521s21c1
Sequence:CCGGGCCCTCAAAGAGAGGATGATTCTCGAGAATCATCCTCTCTTTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001116.2-3358s21c1
Sequence:CCGGGCCCAGACAGTTCTGTATTAACTCGAGTTAATACAGAACTGTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001116.1-998s1c1
Sequence:CCGGGCCCTCAAAGAGAGGATGATTCTCGAGAATCATCCTCTCTTTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001116.1-3721s1c1
Sequence:CCGGCCAGATGAAGACCTACCTGTACTCGAGTACAGGTAGGTCTTCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001116.1-424s1c1
Sequence:CCGGCCACATGAGATCCAGACTGATCTCGAGATCAGTCTGGATCTCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001116.1-2835s1c1
Sequence:CCGGGCCCAGACAGTTCTGTATTAACTCGAGTTAATACAGAACTGTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001116.1-958s1c1
Sequence:CCGGGCAATCCATTATGCACGGGAACTCGAGTTCCCGTGCATAATGGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001116
VALIDATED
ADCY9 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001116.2-947s21c1
Sequence:CCGGCCACATGAGATCCAGACTGATCTCGAGATCAGTCTGGATCTCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001116.2-1481s21c1
Sequence:CCGGGCAATCCATTATGCACGGGAACTCGAGTTCCCGTGCATAATGGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001116.2-1521s21c1
Sequence:CCGGGCCCTCAAAGAGAGGATGATTCTCGAGAATCATCCTCTCTTTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001116.2-3358s21c1
Sequence:CCGGGCCCAGACAGTTCTGTATTAACTCGAGTTAATACAGAACTGTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001116.1-998s1c1
Sequence:CCGGGCCCTCAAAGAGAGGATGATTCTCGAGAATCATCCTCTCTTTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001116.1-3721s1c1
Sequence:CCGGCCAGATGAAGACCTACCTGTACTCGAGTACAGGTAGGTCTTCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001116.1-424s1c1
Sequence:CCGGCCACATGAGATCCAGACTGATCTCGAGATCAGTCTGGATCTCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001116.1-2835s1c1
Sequence:CCGGGCCCAGACAGTTCTGTATTAACTCGAGTTAATACAGAACTGTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001116.1-958s1c1
Sequence:CCGGGCAATCCATTATGCACGGGAACTCGAGTTCCCGTGCATAATGGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001116
VALIDATED
ADCY9 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001116.2-947s21c1
Sequence:CCGGCCACATGAGATCCAGACTGATCTCGAGATCAGTCTGGATCTCATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001116.2-1481s21c1
Sequence:CCGGGCAATCCATTATGCACGGGAACTCGAGTTCCCGTGCATAATGGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001116.2-1521s21c1
Sequence:CCGGGCCCTCAAAGAGAGGATGATTCTCGAGAATCATCCTCTCTTTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001116.2-3358s21c1
Sequence:CCGGGCCCAGACAGTTCTGTATTAACTCGAGTTAATACAGAACTGTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001116.1-998s1c1
Sequence:CCGGGCCCTCAAAGAGAGGATGATTCTCGAGAATCATCCTCTCTTTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001116.1-3721s1c1
Sequence:CCGGCCAGATGAAGACCTACCTGTACTCGAGTACAGGTAGGTCTTCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001116.1-424s1c1
Sequence:CCGGCCACATGAGATCCAGACTGATCTCGAGATCAGTCTGGATCTCATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001116.1-2835s1c1
Sequence:CCGGGCCCAGACAGTTCTGTATTAACTCGAGTTAATACAGAACTGTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001116.1-958s1c1
Sequence:CCGGGCAATCCATTATGCACGGGAACTCGAGTTCCCGTGCATAATGGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009624
VALIDATED
ADCY9 MISSION shRNA Bacterial Glycerol Stock
adenylate cyclase 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009624.1-1192s1c1
Sequence:CCGGCCCTTTAAGATGCAGCAGATTCTCGAGAATCTGCTGCATCTTAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009624.1-4249s1c1
Sequence:CCGGGCACAGTTATTCAGGGTTCATCTCGAGATGAACCCTGAATAACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009624.1-2322s1c1
Sequence:CCGGGCGATCATATAGAACCAGCTACTCGAGTAGCTGGTTCTATATGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009624.1-1932s1c1
Sequence:CCGGCCCTTCTTGTGGAATCACATTCTCGAGAATGTGATTCCACAAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009624.1-445s1c1
Sequence:CCGGGCTGTCCACATGAAATCCAAACTCGAGTTTGGATTTCATGTGGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009624
VALIDATED
ADCY9 MISSION shRNA shRNA Plasmid DNA
adenylate cyclase 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009624.1-1192s1c1
Sequence:CCGGCCCTTTAAGATGCAGCAGATTCTCGAGAATCTGCTGCATCTTAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009624.1-4249s1c1
Sequence:CCGGGCACAGTTATTCAGGGTTCATCTCGAGATGAACCCTGAATAACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009624.1-2322s1c1
Sequence:CCGGGCGATCATATAGAACCAGCTACTCGAGTAGCTGGTTCTATATGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009624.1-1932s1c1
Sequence:CCGGCCCTTCTTGTGGAATCACATTCTCGAGAATGTGATTCCACAAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009624.1-445s1c1
Sequence:CCGGGCTGTCCACATGAAATCCAAACTCGAGTTTGGATTTCATGTGGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009624
VALIDATED
ADCY9 MISSION shRNA Lentiviral Transduction Particles
adenylate cyclase 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009624.1-1192s1c1
Sequence:CCGGCCCTTTAAGATGCAGCAGATTCTCGAGAATCTGCTGCATCTTAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009624.1-4249s1c1
Sequence:CCGGGCACAGTTATTCAGGGTTCATCTCGAGATGAACCCTGAATAACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009624.1-2322s1c1
Sequence:CCGGGCGATCATATAGAACCAGCTACTCGAGTAGCTGGTTCTATATGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009624.1-1932s1c1
Sequence:CCGGCCCTTCTTGTGGAATCACATTCTCGAGAATGTGATTCCACAAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009624.1-445s1c1
Sequence:CCGGGCTGTCCACATGAAATCCAAACTCGAGTTTGGATTTCATGTGGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)