EMAIL THIS PAGE TO A FRIEND

Adh1

35 Gene Product Result for
Species: Mouse Adh1(11522), Rat Adh1(24172), Thale Cress ADH1(844047)
Gene ID:
Rat(24172) alcohol dehydrogenase 1 (class I)
Thale Cress(844047) alcohol dehydrogenase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK053 Alcohol Dehydrogenase Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007409 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007409 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007409 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU005021 MISSION® esiRNA targeting mouse Adh1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019286 Rosetta Predictions rat pricing
NM_007409 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019286 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262217 predicted 387
2 SASI_Rn02_00262218 predicted 1064
3 SASI_Rn02_00262219 predicted 763
4 SASI_Rn01_00092600 predicted 1009
5 SASI_Rn02_00262220 predicted 195
6 SASI_Rn02_00262221 predicted 1230
7 SASI_Rn02_00262222 predicted 213
8 SASI_Rn02_00262223 predicted 1280
9 SASI_Rn02_00262224 predicted 1257
10 SASI_Rn02_00262225 predicted 312
11 SASI_Rn01_00092595 predicted 520
12 SASI_Rn01_00092596 predicted 802
13 SASI_Rn01_00092597 predicted 694
14 SASI_Rn01_00092598 predicted 891
15 SASI_Rn01_00092599 predicted 217
16 SASI_Rn01_00092601 predicted 234
17 SASI_Rn01_00092602 predicted 386
18 SASI_Rn01_00092603 predicted 676
19 SASI_Rn01_00092604 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073661 predicted 1030
2 SASI_Mm01_00073662 predicted 210
3 SASI_Mm01_00073663 predicted 521
4 SASI_Mm02_00311549 predicted 560
5 SASI_Mm01_00073665 predicted 1093
6 SASI_Mm02_00311550 predicted 794
7 SASI_Mm01_00073667 predicted 515
8 SASI_Mm02_00311551 predicted 616
9 SASI_Mm02_00311552 predicted 648
10 SASI_Mm01_00073669 predicted 1044
11 SASI_Mm01_00073664 predicted 475
12 SASI_Mm01_00073666 predicted 1028
13 SASI_Mm01_00073668 predicted 774
14 SASI_Mm01_00073670 predicted 585
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007409
Adh1 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007409.2-1061s1c1
Sequence:CCGGCCCTAAACTTGTGGCTGACTTCTCGAGAAGTCAGCCACAAGTTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007409.2-572s1c1
Sequence:CCGGACTGGACAAAGTCTGCCTCATCTCGAGATGAGGCAGACTTTGTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007409.2-1036s1c1
Sequence:CCGGGCGGGTTTAAGAGTAAAGATTCTCGAGAATCTTTACTCTTAAACCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007409.2-886s1c1
Sequence:CCGGGCCGCCTTGACACCATGACTTCTCGAGAAGTCATGGTGTCAAGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007409.2-336s1c1
Sequence:CCGGGATAAAGTCATTCCACTCTTTCTCGAGAAAGAGTGGAATGACTTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007409
Adh1 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007409.2-1061s1c1
Sequence:CCGGCCCTAAACTTGTGGCTGACTTCTCGAGAAGTCAGCCACAAGTTTAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000042007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007409.2-572s1c1
Sequence:CCGGACTGGACAAAGTCTGCCTCATCTCGAGATGAGGCAGACTTTGTCCAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000042003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007409.2-1036s1c1
Sequence:CCGGGCGGGTTTAAGAGTAAAGATTCTCGAGAATCTTTACTCTTAAACCCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000042006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007409.2-886s1c1
Sequence:CCGGGCCGCCTTGACACCATGACTTCTCGAGAAGTCATGGTGTCAAGGCGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000042005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007409.2-336s1c1
Sequence:CCGGGATAAAGTCATTCCACTCTTTCTCGAGAAAGAGTGGAATGACTTTATCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007409
Adh1 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007409.2-1061s1c1
Sequence:CCGGCCCTAAACTTGTGGCTGACTTCTCGAGAAGTCAGCCACAAGTTTAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007409.2-572s1c1
Sequence:CCGGACTGGACAAAGTCTGCCTCATCTCGAGATGAGGCAGACTTTGTCCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007409.2-1036s1c1
Sequence:CCGGGCGGGTTTAAGAGTAAAGATTCTCGAGAATCTTTACTCTTAAACCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007409.2-886s1c1
Sequence:CCGGGCCGCCTTGACACCATGACTTCTCGAGAAGTCATGGTGTCAAGGCGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000042005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007409.2-336s1c1
Sequence:CCGGGATAAAGTCATTCCACTCTTTCTCGAGAAAGAGTGGAATGACTTTATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???