EMAIL THIS PAGE TO A FRIEND

ADH4

alcohol dehydrogenase 4 (class II), pi polypeptide

59 Gene Product Result for
Synonyms: ADH-2
UniProtKB ID: P08319, A8K470, B4DIE7, C9J4A9, Q8TCD7
Gene ID:
Human(127) Summary: This gene encodes class II alcohol dehydrogenase 4 pi subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class II alcohol dehydrogenase is a homodimer composed of 2 pi subunits. It exhibits a high activity for oxidation of long-chain aliphatic alcohols and aromatic alcohols and is less sensitive to pyrazole. This gene is localized to chromosome 4 in the cluster of alcohol dehydrogenase genes. [provided by RefSeq, Jul 2008]
Mouse(26876) alcohol dehydrogenase 4 (class II), pi polypeptide
Rat(29646) alcohol dehydrogenase 4 (class II), pi polypeptide
cow(520508) alcohol dehydrogenase 4 (class II), pi polypeptide
domestic cat(101101050) alcohol dehydrogenase 4 (class II), pi polypeptide
dog(478487) alcohol dehydrogenase 4 (class II), pi polypeptide
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
120685 N-Cyclohexylformamide 99% human, mouse pricing

Kits

Product # Description Species Add to Cart
 
MAK053 Alcohol Dehydrogenase Activity Assay Kit sufficient for 100 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011996 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011996 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011996 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000670 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000670 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000670 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000670 Rosetta Predictions human pricing
NM_017270 Rosetta Predictions rat pricing
NM_011996 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303038 predicted 737
2 SASI_Hs01_00150268 predicted 976
3 SASI_Hs02_00303039 predicted 265
4 SASI_Hs01_00150270 predicted 320
5 SASI_Hs01_00150271 predicted 1166
6 SASI_Hs02_00303040 predicted 1161
7 SASI_Hs01_00150272 predicted 394
8 SASI_Hs01_00150273 predicted 1074
9 SASI_Hs01_00150274 predicted 1009
10 SASI_Hs01_00150275 predicted 772
11 SASI_Hs01_00150269 predicted 1027
12 SASI_Hs01_00150276 predicted 555
13 SASI_Hs01_00150277 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017270 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261678 predicted 740
2 SASI_Rn01_00045432 predicted 994
3 SASI_Rn02_00261679 predicted 317
4 SASI_Rn01_00045434 predicted 1056
5 SASI_Rn01_00045435 predicted 1011
6 SASI_Rn01_00045436 predicted 729
7 SASI_Rn01_00045438 predicted 491
8 SASI_Rn01_00045439 predicted 320
9 SASI_Rn01_00045440 predicted 425
10 SASI_Rn01_00045441 predicted 591
11 SASI_Rn01_00045433 predicted 461
12 SASI_Rn01_00045437 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011996 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079195 predicted 422
2 SASI_Mm01_00079196 predicted 1087
3 SASI_Mm01_00079197 predicted 711
4 SASI_Mm01_00079198 predicted 977
5 SASI_Mm02_00321924 predicted 275
6 SASI_Mm01_00079200 predicted 446
7 SASI_Mm01_00079201 predicted 289
8 SASI_Mm02_00321925 predicted 356
9 SASI_Mm01_00079202 predicted 960
10 SASI_Mm01_00079203 predicted 310
11 SASI_Mm01_00079194 predicted 1087
12 SASI_Mm01_00079199 predicted 911
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011996
ADH4 MISSION shRNA Bacterial Glycerol Stock
alcohol dehydrogenase 4 (class II), pi polypeptide
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011996.2-953s21c1
Sequence:CCGGACCCACCGTGGACGTTATATTCTCGAGAATATAACGTCCACGGTGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011996.2-658s21c1
Sequence:CCGGTAGGTCTTTCTGCCATAATTGCTCGAGCAATTATGGCAGAAAGACCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011996.1-1188s1c1
Sequence:CCGGCATCCGAACAATCCTGACCTTCTCGAGAAGGTCAGGATTGTTCGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011996.1-965s1c1
Sequence:CCGGCCGTTCTATAAATGGAACATTCTCGAGAATGTTCCATTTATAGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011996.1-1078s1c1
Sequence:CCGGCCCTACCTTTCGAGAGCATAACTCGAGTTATGCTCTCGAAAGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011996.1-430s1c1
Sequence:CCGGCCTGCAAAGGAAGATCAATTTCTCGAGAAATTGATCTTCCTTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011996.1-464s1c1
Sequence:CCGGCGTCAGTTCATTCTCTCAATACTCGAGTATTGAGAGAATGAACTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011996
ADH4 MISSION shRNA shRNA Plasmid DNA
alcohol dehydrogenase 4 (class II), pi polypeptide
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011996.2-953s21c1
Sequence:CCGGACCCACCGTGGACGTTATATTCTCGAGAATATAACGTCCACGGTGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011996.2-658s21c1
Sequence:CCGGTAGGTCTTTCTGCCATAATTGCTCGAGCAATTATGGCAGAAAGACCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011996.1-1188s1c1
Sequence:CCGGCATCCGAACAATCCTGACCTTCTCGAGAAGGTCAGGATTGTTCGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011996.1-965s1c1
Sequence:CCGGCCGTTCTATAAATGGAACATTCTCGAGAATGTTCCATTTATAGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011996.1-1078s1c1
Sequence:CCGGCCCTACCTTTCGAGAGCATAACTCGAGTTATGCTCTCGAAAGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011996.1-430s1c1
Sequence:CCGGCCTGCAAAGGAAGATCAATTTCTCGAGAAATTGATCTTCCTTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011996.1-464s1c1
Sequence:CCGGCGTCAGTTCATTCTCTCAATACTCGAGTATTGAGAGAATGAACTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011996
ADH4 MISSION shRNA Lentiviral Transduction Particles
alcohol dehydrogenase 4 (class II), pi polypeptide
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011996.2-953s21c1
Sequence:CCGGACCCACCGTGGACGTTATATTCTCGAGAATATAACGTCCACGGTGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011996.2-658s21c1
Sequence:CCGGTAGGTCTTTCTGCCATAATTGCTCGAGCAATTATGGCAGAAAGACCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011996.1-1188s1c1
Sequence:CCGGCATCCGAACAATCCTGACCTTCTCGAGAAGGTCAGGATTGTTCGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011996.1-965s1c1
Sequence:CCGGCCGTTCTATAAATGGAACATTCTCGAGAATGTTCCATTTATAGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011996.1-1078s1c1
Sequence:CCGGCCCTACCTTTCGAGAGCATAACTCGAGTTATGCTCTCGAAAGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011996.1-430s1c1
Sequence:CCGGCCTGCAAAGGAAGATCAATTTCTCGAGAAATTGATCTTCCTTTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011996.1-464s1c1
Sequence:CCGGCGTCAGTTCATTCTCTCAATACTCGAGTATTGAGAGAATGAACTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000670
ADH4 MISSION shRNA Bacterial Glycerol Stock
alcohol dehydrogenase 4 (class II), pi polypeptide
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000670.3-1367s21c1
Sequence:CCGGTAGACTTTGTACCTGTTATATCTCGAGATATAACAGGTACAAAGTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000670.3-983s21c1
Sequence:CCGGGGTAGCAAAGGATTGACTATTCTCGAGAATAGTCAATCCTTTGCTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000670.3-1258s21c1
Sequence:CCGGGTGAACCTGCCTGGTTAATTTCTCGAGAAATTAACCAGGCAGGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000670.3-1160s21c1
Sequence:CCGGAGTGAGGCATTTGACCTAATGCTCGAGCATTAGGTCAAATGCCTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000670.2-617s1c1
Sequence:CCGGGCCATACTGATGCCAGTGTTACTCGAGTAACACTGGCATCAGTATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000670.2-1596s1c1
Sequence:CCGGCGTCCGAACAATCCTCATCTTCTCGAGAAGATGAGGATTGTTCGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000670.2-691s1c1
Sequence:CCGGGCAGGTATTGTGGAAAGTATTCTCGAGAATACTTTCCACAATACCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000670.2-1141s1c1
Sequence:CCGGGCTTCCAGAATCATAGGTATTCTCGAGAATACCTATGATTCTGGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000670
ADH4 MISSION shRNA shRNA Plasmid DNA
alcohol dehydrogenase 4 (class II), pi polypeptide
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000670.3-1367s21c1
Sequence:CCGGTAGACTTTGTACCTGTTATATCTCGAGATATAACAGGTACAAAGTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000670.3-983s21c1
Sequence:CCGGGGTAGCAAAGGATTGACTATTCTCGAGAATAGTCAATCCTTTGCTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000670.3-1258s21c1
Sequence:CCGGGTGAACCTGCCTGGTTAATTTCTCGAGAAATTAACCAGGCAGGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000670.3-1160s21c1
Sequence:CCGGAGTGAGGCATTTGACCTAATGCTCGAGCATTAGGTCAAATGCCTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000670.2-617s1c1
Sequence:CCGGGCCATACTGATGCCAGTGTTACTCGAGTAACACTGGCATCAGTATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000670.2-1596s1c1
Sequence:CCGGCGTCCGAACAATCCTCATCTTCTCGAGAAGATGAGGATTGTTCGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000670.2-691s1c1
Sequence:CCGGGCAGGTATTGTGGAAAGTATTCTCGAGAATACTTTCCACAATACCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000670.2-1141s1c1
Sequence:CCGGGCTTCCAGAATCATAGGTATTCTCGAGAATACCTATGATTCTGGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000670
ADH4 MISSION shRNA Lentiviral Transduction Particles
alcohol dehydrogenase 4 (class II), pi polypeptide
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000670.3-1367s21c1
Sequence:CCGGTAGACTTTGTACCTGTTATATCTCGAGATATAACAGGTACAAAGTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000670.3-983s21c1
Sequence:CCGGGGTAGCAAAGGATTGACTATTCTCGAGAATAGTCAATCCTTTGCTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000670.3-1258s21c1
Sequence:CCGGGTGAACCTGCCTGGTTAATTTCTCGAGAAATTAACCAGGCAGGTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000670.3-1160s21c1
Sequence:CCGGAGTGAGGCATTTGACCTAATGCTCGAGCATTAGGTCAAATGCCTCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000670.2-617s1c1
Sequence:CCGGGCCATACTGATGCCAGTGTTACTCGAGTAACACTGGCATCAGTATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000670.2-1596s1c1
Sequence:CCGGCGTCCGAACAATCCTCATCTTCTCGAGAAGATGAGGATTGTTCGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000670.2-691s1c1
Sequence:CCGGGCAGGTATTGTGGAAAGTATTCTCGAGAATACTTTCCACAATACCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000670.2-1141s1c1
Sequence:CCGGGCTTCCAGAATCATAGGTATTCTCGAGAATACCTATGATTCTGGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)