EMAIL THIS PAGE TO A FRIEND

ADI1

acireductone dioxygenase 1

64 Gene Product Result for
Synonyms: APL1 ARD Fe-ARD MTCBP1 Ni-ARD SIPL mtnD
Gene ID:
Human(55256) Summary: This gene encodes an enzyme that belongs to the aci-reductone dioxygenase family of metal-binding enzymes, which are involved in methionine salvage. This enzyme may regulate mRNA processing in the nucleus, and may carry out different functions depending on its localization. Related pseudogenes have been defined on chromosomes 8 and 20. [provided by RefSeq, May 2010]
Mouse(104923) acireductone dioxygenase 1
Rat(298934) acireductone dioxygenase 1
Zebrafish(324079) acireductone dioxygenase 1
chicken(421918) acireductone dioxygenase 1
cow(615764) acireductone dioxygenase 1
domestic cat(101097719) acireductone dioxygenase 1
naked mole-rat(101715211) acireductone dioxygenase 1
domestic guinea pig(100725625) acireductone dioxygenase 1
sheep(101113992) acireductone dioxygenase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018269 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134052 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134052 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134052 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018269 Rosetta Predictions human pricing
NM_199097 Rosetta Predictions rat pricing
NM_134052 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046782 predicted 878
2 SASI_Hs01_00046783 predicted 875
3 SASI_Hs01_00046784 predicted 787
4 SASI_Hs02_00351636 predicted 294
5 SASI_Hs01_00046786 predicted 260
6 SASI_Hs01_00046787 predicted 864
7 SASI_Hs01_00046788 predicted 780
8 SASI_Hs01_00046789 predicted 648
9 SASI_Hs02_00351637 predicted 876
10 SASI_Hs01_00046790 predicted 896
11 SASI_Hs01_00046785 predicted 925
12 SASI_Hs01_00046791 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030041 predicted 221
2 SASI_Rn01_00030042 predicted 199
3 SASI_Rn01_00030043 predicted 207
4 SASI_Rn01_00030044 predicted 223
5 SASI_Rn01_00030045 predicted 224
6 SASI_Rn02_00270113 predicted 241
7 SASI_Rn01_00030046 predicted 209
8 SASI_Rn02_00270114 predicted 240
9 SASI_Rn01_00030047 predicted 233
10 SASI_Rn02_00270115 predicted 262
11 SASI_Rn01_00030048 predicted 272
12 SASI_Rn01_00030049 predicted 258
13 SASI_Rn01_00030050 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339215 predicted 924
2 SASI_Mm02_00339216 predicted 1032
3 SASI_Mm01_00187258 predicted 799
4 SASI_Mm01_00187259 predicted 543
5 SASI_Mm02_00339217 predicted 575
6 SASI_Mm01_00187262 predicted 240
7 SASI_Mm01_00187263 predicted 841
8 SASI_Mm02_00339218 predicted 479
9 SASI_Mm02_00339219 predicted 857
10 SASI_Mm02_00339220 predicted 242
11 SASI_Mm01_00187260 predicted 701
12 SASI_Mm01_00187261 predicted 258
13 SASI_Mm01_00187264 predicted 299
14 SASI_Mm01_00187265 predicted 578
15 SASI_Mm01_00187266 predicted 884
16 SASI_Mm01_00187267 predicted 307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018269
VALIDATED
ADI1 MISSION shRNA Bacterial Glycerol Stock
acireductone dioxygenase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018269.2-648s21c1
Sequence:CCGGACTAACACGTGCCTCGTAAAGCTCGAGCTTTACGAGGCACGTGTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018269.2-509s21c1
Sequence:CCGGGAAGAACTACACGAAGGCCATCTCGAGATGGCCTTCGTGTAGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018269.2-269s21c1
Sequence:CCGGGAACTACTCCTGGATGGACATCTCGAGATGTCCATCCAGGAGTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018269.2-351s21c1
Sequence:CCGGGAGCATTTGCACTTGGACGATCTCGAGATCGTCCAAGTGCAAATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018269.1-461s1c1
Sequence:CCGGGAAGAACTACACGAAGGCCATCTCGAGATGGCCTTCGTGTAGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018269.1-303s1c1
Sequence:CCGGGAGCATTTGCACTTGGACGATCTCGAGATCGTCCAAGTGCAAATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018269.1-237s1c1
Sequence:CCGGGACATCATAACCATATGCAAACTCGAGTTTGCATATGGTTATGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018269.1-221s1c1
Sequence:CCGGGAACTACTCCTGGATGGACATCTCGAGATGTCCATCCAGGAGTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018269.1-171s1c1
Sequence:CCGGGCTGACAAATATGAGAATGATCTCGAGATCATTCTCATATTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018269
VALIDATED
ADI1 MISSION shRNA shRNA Plasmid DNA
acireductone dioxygenase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018269.2-648s21c1
Sequence:CCGGACTAACACGTGCCTCGTAAAGCTCGAGCTTTACGAGGCACGTGTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018269.2-509s21c1
Sequence:CCGGGAAGAACTACACGAAGGCCATCTCGAGATGGCCTTCGTGTAGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018269.2-269s21c1
Sequence:CCGGGAACTACTCCTGGATGGACATCTCGAGATGTCCATCCAGGAGTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018269.2-351s21c1
Sequence:CCGGGAGCATTTGCACTTGGACGATCTCGAGATCGTCCAAGTGCAAATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018269.1-461s1c1
Sequence:CCGGGAAGAACTACACGAAGGCCATCTCGAGATGGCCTTCGTGTAGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018269.1-303s1c1
Sequence:CCGGGAGCATTTGCACTTGGACGATCTCGAGATCGTCCAAGTGCAAATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018269.1-237s1c1
Sequence:CCGGGACATCATAACCATATGCAAACTCGAGTTTGCATATGGTTATGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018269.1-221s1c1
Sequence:CCGGGAACTACTCCTGGATGGACATCTCGAGATGTCCATCCAGGAGTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018269.1-171s1c1
Sequence:CCGGGCTGACAAATATGAGAATGATCTCGAGATCATTCTCATATTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018269
VALIDATED
ADI1 MISSION shRNA Lentiviral Transduction Particles
acireductone dioxygenase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018269.2-648s21c1
Sequence:CCGGACTAACACGTGCCTCGTAAAGCTCGAGCTTTACGAGGCACGTGTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018269.2-509s21c1
Sequence:CCGGGAAGAACTACACGAAGGCCATCTCGAGATGGCCTTCGTGTAGTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018269.2-269s21c1
Sequence:CCGGGAACTACTCCTGGATGGACATCTCGAGATGTCCATCCAGGAGTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018269.2-351s21c1
Sequence:CCGGGAGCATTTGCACTTGGACGATCTCGAGATCGTCCAAGTGCAAATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018269.1-461s1c1
Sequence:CCGGGAAGAACTACACGAAGGCCATCTCGAGATGGCCTTCGTGTAGTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018269.1-303s1c1
Sequence:CCGGGAGCATTTGCACTTGGACGATCTCGAGATCGTCCAAGTGCAAATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018269.1-237s1c1
Sequence:CCGGGACATCATAACCATATGCAAACTCGAGTTTGCATATGGTTATGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018269.1-221s1c1
Sequence:CCGGGAACTACTCCTGGATGGACATCTCGAGATGTCCATCCAGGAGTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018269.1-171s1c1
Sequence:CCGGGCTGACAAATATGAGAATGATCTCGAGATCATTCTCATATTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134052
VALIDATED
ADI1 MISSION shRNA Bacterial Glycerol Stock
acireductone dioxygenase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134052.1-256s1c1
Sequence:CCGGCAAAGATACACTTCCCAATTACTCGAGTAATTGGGAAGTGTATCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134052.1-281s1c1
Sequence:CCGGGAGAAGATCAAGATGTTCTTTCTCGAGAAAGAACATCTTGATCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134052.1-487s1c1
Sequence:CCGGGCTGTTTGTTGGAGAACCTGTCTCGAGACAGGTTCTCCAACAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134052.1-255s1c1
Sequence:CCGGGCAAAGATACACTTCCCAATTCTCGAGAATTGGGAAGTGTATCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134052.1-859s1c1
Sequence:CCGGGCCAATCTTCATCTCCCAGATCTCGAGATCTGGGAGATGAAGATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134052
VALIDATED
ADI1 MISSION shRNA shRNA Plasmid DNA
acireductone dioxygenase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134052.1-256s1c1
Sequence:CCGGCAAAGATACACTTCCCAATTACTCGAGTAATTGGGAAGTGTATCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134052.1-281s1c1
Sequence:CCGGGAGAAGATCAAGATGTTCTTTCTCGAGAAAGAACATCTTGATCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134052.1-487s1c1
Sequence:CCGGGCTGTTTGTTGGAGAACCTGTCTCGAGACAGGTTCTCCAACAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134052.1-255s1c1
Sequence:CCGGGCAAAGATACACTTCCCAATTCTCGAGAATTGGGAAGTGTATCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134052.1-859s1c1
Sequence:CCGGGCCAATCTTCATCTCCCAGATCTCGAGATCTGGGAGATGAAGATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134052
VALIDATED
ADI1 MISSION shRNA Lentiviral Transduction Particles
acireductone dioxygenase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134052.1-256s1c1
Sequence:CCGGCAAAGATACACTTCCCAATTACTCGAGTAATTGGGAAGTGTATCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134052.1-281s1c1
Sequence:CCGGGAGAAGATCAAGATGTTCTTTCTCGAGAAAGAACATCTTGATCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134052.1-487s1c1
Sequence:CCGGGCTGTTTGTTGGAGAACCTGTCTCGAGACAGGTTCTCCAACAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134052.1-255s1c1
Sequence:CCGGGCAAAGATACACTTCCCAATTCTCGAGAATTGGGAAGTGTATCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134052.1-859s1c1
Sequence:CCGGGCCAATCTTCATCTCCCAGATCTCGAGATCTGGGAGATGAAGATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)