EMAIL THIS PAGE TO A FRIEND

ADRA2A

adrenoceptor alpha 2A

208 Gene Product Result for
Synonyms: ADRA2 ADRA2R ADRAR ALPHA2AAR ZNF32
UniProtKB ID: P08913, B0LPF6, Q2I8G2, Q2XN99, Q86TH8, Q9BZK1
Gene ID:
Human(150) Summary: Alpha-2-adrenergic receptors are members of the G protein-coupled receptor superfamily. They include 3 highly homologous subtypes: alpha2A, alpha2B, and alpha2C. These receptors have a critical role in regulating neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. Studies in mouse revealed that both the alpha2A and alpha2C subtypes were required for normal presynaptic control of transmitter release from sympathetic nerves in the heart and from central noradrenergic neurons; the alpha2A subtype inhibited transmitter release at high stimulation frequencies, whereas the alpha2C subtype modulated neurotransmission at lower levels of nerve activity. This gene encodes alpha2A subtype and it contains no introns in either its coding or untranslated sequences. [provided by RefSeq, Jul 2008]
Mouse(11551) adrenergic receptor, alpha 2a
Rat(25083) adrenoceptor alpha 2A
domestic guinea pig(100135475) adrenergic receptor, alpha 2a
naked mole-rat(101723298) adrenoceptor alpha 2A
sheep(101117291) adrenoceptor alpha 2A
sheep(100170317) adrenoceptor alpha 2A
Domestic Rabbit(100009424) adrenoceptor alpha 2A
Zebrafish(266750) adrenergic, alpha-2A-, receptor
chicken(428980) adrenergic, alpha-2A-, receptor
cow(282135) adrenergic, alpha-2A-, receptor
domestic cat(664736) adrenoceptor alpha 2A
dog(486888) adrenoceptor alpha 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A271 Anti-α2A Adrenergic Receptor antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, pig, human, mouse
immunohistochemistry, western blot pricing
SAB2500033 Anti-ADRA2A antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rat, canine
ELISA, immunocytochemistry, immunofluorescence pricing
SAB4500549 Anti-ADRA2A antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence pricing
SAB4500548 Anti-Adrenergic Receptor α-2A antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
E4642 (±)-Epinephrine hydrochloride human pricing
A0937 (±)-Norepinephrine (+)-bitartrate salt human pricing
O0250 (±)-Octopamine hydrochloride ≥95%, solid human pricing
S0752 (±)-Synephrine ≥98% human pricing
857416 (−)-3-(3,4-Dihydroxyphenyl)-2-methyl-L-alanine sesquihydrate 99% human pricing
E4375 (−)-Epinephrine (+)-bitartrate salt solid human pricing
Y0000882 Adrenaline European Pharmacopoeia (EP) Reference Standard human pricing
BP003 Adrenaline acid tartrate British Pharmacopoeia (BP) Reference Standard human pricing
A0300000 Adrenaline tartrate European Pharmacopoeia (EP) Reference Standard human pricing
Y0000707 Adrenaline tartrate with impurity A European Pharmacopoeia (EP) Reference Standard human pricing
Y0000883 Adrenaline with impurity F European Pharmacopoeia (EP) Reference Standard human pricing
C7897 Clonidine hydrochloride solid human pricing
1140407 Clonidine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C2400000 Clonidine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP085 Clonidine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
C-033 Clonidine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1237000 Epinephrine bitartrate United States Pharmacopeia (USP) Reference Standard human pricing
PHR1509 Epinephrine Bitartrate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
45510 Ergotamine D-tartrate ≥97.0% (calc. based on dry substance, NT) human pricing
1241506 Ergotamine tartrate United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 1313.41 ((C33H35N5O5)2 · C4H6O6) human pricing
E1200000 Ergotamine tartrate European Pharmacopoeia (EP) Reference Standard human pricing
BP141 Ergotamine tartrate British Pharmacopoeia (BP) Reference Standard human pricing
1301404 Guanabenz acetate United States Pharmacopeia (USP) Reference Standard human pricing
G110 Guanabenz acetate salt powder human pricing
G1043 Guanfacine hydrochloride ≥98% (HPLC) human pricing
PHR1751 Guanfacine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1302101 Guanfacine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
74480 L-Norepinephrine hydrochloride ≥98.0% (sum of enantiomers, HPLC) human pricing
D9446 L-DOPS ≥98% (HPLC) human pricing
1362500 Levonordefrin United States Pharmacopeia (USP) Reference Standard human pricing
1426002 Methyldopa United States Pharmacopeia (USP) Reference Standard human pricing
M1500000 Methyldopa European Pharmacopoeia (EP) Reference Standard human pricing
BP240 Methyldopa British Pharmacopoeia (BP) Reference Standard human pricing
Y0001083 Methyldopa for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
M1559 Moxonidine hydrochloride ≥98% human pricing
PHR1836 Naphazoline hydrochloride Pharmaceutical Secondary Standard; Certified Reference Materialr human pricing
N5504 Naphazoline hydrochloride human pricing
1457006 Naphazoline hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
N0080000 Naphazoline hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
O2378 Oxymetazoline hydrochloride ≥99%, solid human pricing
1486004 Oxymetazoline hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
55591 Oxymetazoline hydrochloride analytical standard human pricing
O0290000 Oxymetazoline hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
PHR1572 Oxymetazoline Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
A0779 p-Aminoclonidine hydrochloride solid human pricing
I114 p-Iodoclonidine hydrochloride analytical standard, for drug analysis human pricing
PHR1853 Tetrahydrozoline hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
T4264 Tetrahydrozoline hydrochloride ≥98% (HPLC) human pricing
1652001 Tetrahydrozoline hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0000460 Tetrahydrozoline hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
T6950 Tizanidine hydrochloride ≥98% (HPLC), powder human pricing
Y0001700 Tizanidine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
T-085 Tizanidine hydrochloride 500 μg/mL in methanol, certified reference material, Cerilliant® human pricing
1667905 Tizanidine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
X1251 Xylazine hydrochloride ≥99.0% (HPLC) human pricing
X6000 Xylometazoline hydrochloride human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
293490 2-Benzylimidazoline 99% human pricing
A7127 Agmatine sulfate salt ≥97%, powder human pricing
E3263 Efaroxan hydrochloride ≥98% (HPLC) human pricing
F6145 Fenspiride hydrochloride analytical standard, for drug analysis human pricing
I6138 Idazoxan hydrochloride human pricing
L1011 Labetalol hydrochloride >98% (TLC), powder human pricing
1356654 Labetalol hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
L0050000 Labetalol hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
PHR1335 Labetalol Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0000705 Mirtazapine European Pharmacopoeia (EP) Reference Standard human pricing
BP842 Mirtazapine British Pharmacopoeia (BP) Reference Standard human pricing
1444279 Mirtazapine United States Pharmacopeia (USP) Reference Standard human pricing
Y0000721 Mirtazapine for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
M-128 Mirtazapine solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M5154 Moxisylyte hydrochloride >99% (TLC), powder human pricing
P6402 Perphenazine human pricing
B019 Phenoxybenzamine hydrochloride ≥97%, powder human pricing
1526007 Phenoxybenzamine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
BP1072 Phenoxybenzamine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
PHR1402 Phenoxybenzamine Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
P7547 Phentolamine hydrochloride ≥98% (TLC), powder human pricing
BP520 Phentolamine mesilate British Pharmacopoeia (BP) Reference Standard human pricing
Y0001127 Phentolamine mesilate European Pharmacopoeia (EP) Reference Standard human pricing
Y0001251 Phentolamine mesilate for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
1530004 Phentolamine mesylate United States Pharmacopeia (USP) Reference Standard human pricing
PHR1403 Phentolamine Mesylate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
P7561 Phentolamine methanesulfonate salt ≥98% (TLC), powder human pricing
R9525 RX 821002 hydrochloride solid, ≥98% (HPLC) human pricing
S1563 SKF-86466 hydrochloride solid, ≥98% (HPLC) human pricing
1669004 Tolazoline hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y3125 Yohimbine hydrochloride ≥98% (HPLC), powder human pricing
M0443 Mirtazapine ≥98% (HPLC) human, mouse, rat pricing
E4250 (−)-Epinephrine human, rat pricing
A7257 (−)-Norepinephrine ≥98%, crystalline human, rat pricing
T13005 1,2,3,4-Tetrahydroisoquinoline 95% human, rat pricing
B9308 BP897 >98% (HPLC), solid human, rat pricing
C6305 Clozapine human, rat pricing
H1512 Haloperidol powder human, rat pricing
51330 Harmaline ≥95% human, rat pricing
S7395 Spiperone solid human, rat pricing
494186 (S)-(−)-1,2,3,4-Tetrahydro-3-isoquinolinemethanol 98% rat pricing
127035 1-Naphthylmethylamine 97% rat pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
M2525 Mianserin hydrochloride human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
U104 UK 14,304 human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007417 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007417 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007417 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000681 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000681 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000681 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000681 Rosetta Predictions human pricing
NM_012739 Rosetta Predictions rat pricing
NM_007417 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234408 predicted 2695
2 SASI_Hs01_00234409 predicted 2601
3 SASI_Hs01_00234410 predicted 2133
4 SASI_Hs01_00234411 predicted 2490
5 SASI_Hs01_00234412 predicted 1447
6 SASI_Hs02_00303079 predicted 2144
7 SASI_Hs01_00234413 predicted 2172
8 SASI_Hs01_00234414 predicted 1150
9 SASI_Hs01_00234415 predicted 1261
10 SASI_Hs01_00234416 predicted 1005
11 SASI_Hs01_00234417 predicted 2551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117058 predicted 376
2 SASI_Rn01_00117059 predicted 281
3 SASI_Rn02_00260089 predicted 1260
4 SASI_Rn01_00117060 predicted 265
5 SASI_Rn01_00117061 predicted 567
6 SASI_Rn01_00117063 predicted 1288
7 SASI_Rn01_00117064 predicted 550
8 SASI_Rn01_00117065 predicted 499
9 SASI_Rn01_00117066 predicted 502
10 SASI_Rn01_00117067 predicted 374
11 SASI_Rn01_00117062 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027654 predicted 1234
2 SASI_Mm01_00027655 predicted 1356
3 SASI_Mm01_00027658 predicted 1730
4 SASI_Mm01_00027659 predicted 1350
5 SASI_Mm01_00027660 predicted 1576
6 SASI_Mm01_00027661 predicted 1363
7 SASI_Mm02_00311562 predicted 1207
8 SASI_Mm02_00311563 predicted 1362
9 SASI_Mm02_00311564 predicted 1380
10 SASI_Mm02_00311565 predicted 1638
11 SASI_Mm01_00027653 predicted 2750
12 SASI_Mm01_00027656 predicted 2637
13 SASI_Mm01_00027657 predicted 2603
14 SASI_Mm01_00027662 predicted 2725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007417
ADRA2A MISSION shRNA Bacterial Glycerol Stock
adrenoceptor alpha 2A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007417.4-1362s21c1
Sequence:CCGGTTATGGGTTACTGGTACTTTGCTCGAGCAAAGTACCAGTAACCCATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007417.4-2799s21c1
Sequence:CCGGCCTCTAGTCCTGGCTAATTATCTCGAGATAATTAGCCAGGACTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007417.4-1386s21c1
Sequence:CCGGAGGTGTGGTGTGAGATCTATTCTCGAGAATAGATCTCACACCACACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-156s1c1
Sequence:CCGGGCTGGTTATTATCGCGGTGTTCTCGAGAACACCGCGATAATAACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-651s1c1
Sequence:CCGGGCGTATTTACCAGATCGCCAACTCGAGTTGGCGATCTGGTAAATACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-501s1c1
Sequence:CCGGGCCACTCATCTCCATAGAGAACTCGAGTTCTCTATGGAGATGAGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-573s1c1
Sequence:CCGGCGACCAGAAGTGGTATGTCATCTCGAGATGACATACCACTTCTGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-126s1c1
Sequence:CCGGGCTCATGCTGTTCACAGTATTCTCGAGAATACTGTGAACAGCATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007417
ADRA2A MISSION shRNA shRNA Plasmid DNA
adrenoceptor alpha 2A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007417.4-1362s21c1
Sequence:CCGGTTATGGGTTACTGGTACTTTGCTCGAGCAAAGTACCAGTAACCCATAATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000423252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007417.4-2799s21c1
Sequence:CCGGCCTCTAGTCCTGGCTAATTATCTCGAGATAATTAGCCAGGACTAGAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000418624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007417.4-1386s21c1
Sequence:CCGGAGGTGTGGTGTGAGATCTATTCTCGAGAATAGATCTCACACCACACCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000012148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-156s1c1
Sequence:CCGGGCTGGTTATTATCGCGGTGTTCTCGAGAACACCGCGATAATAACCAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000012152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-651s1c1
Sequence:CCGGGCGTATTTACCAGATCGCCAACTCGAGTTGGCGATCTGGTAAATACGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000012149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-501s1c1
Sequence:CCGGGCCACTCATCTCCATAGAGAACTCGAGTTCTCTATGGAGATGAGTGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000012150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-573s1c1
Sequence:CCGGCGACCAGAAGTGGTATGTCATCTCGAGATGACATACCACTTCTGGTCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000012151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-126s1c1
Sequence:CCGGGCTCATGCTGTTCACAGTATTCTCGAGAATACTGTGAACAGCATGAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007417
ADRA2A MISSION shRNA Lentiviral Transduction Particles
adrenoceptor alpha 2A
Mouse
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000429294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007417.4-1362s21c1
Sequence:CCGGTTATGGGTTACTGGTACTTTGCTCGAGCAAAGTACCAGTAACCCATAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007417.4-2799s21c1
Sequence:CCGGCCTCTAGTCCTGGCTAATTATCTCGAGATAATTAGCCAGGACTAGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007417.4-1386s21c1
Sequence:CCGGAGGTGTGGTGTGAGATCTATTCTCGAGAATAGATCTCACACCACACCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-156s1c1
Sequence:CCGGGCTGGTTATTATCGCGGTGTTCTCGAGAACACCGCGATAATAACCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-651s1c1
Sequence:CCGGGCGTATTTACCAGATCGCCAACTCGAGTTGGCGATCTGGTAAATACGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-501s1c1
Sequence:CCGGGCCACTCATCTCCATAGAGAACTCGAGTTCTCTATGGAGATGAGTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-573s1c1
Sequence:CCGGCGACCAGAAGTGGTATGTCATCTCGAGATGACATACCACTTCTGGTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007417.1-126s1c1
Sequence:CCGGGCTCATGCTGTTCACAGTATTCTCGAGAATACTGTGAACAGCATGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000681
VALIDATED
ADRA2A MISSION shRNA Bacterial Glycerol Stock
adrenoceptor alpha 2A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1595s21c1
Sequence:CCGGGTACGTCATCTCGTCGTGCATCTCGAGATGCACGACGAGATGACGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000681.3-2738s21c1
Sequence:CCGGTTACCTAGCCCTGGCTAATTCCTCGAGGAATTAGCCAGGGCTAGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1168s21c1
Sequence:CCGGTCGTCATCATCGCCGTGTTCACTCGAGTGAACACGGCGATGATGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1316s21c1
Sequence:CCGGCAAGGCTTGGTGCGAGATCTACTCGAGTAGATCTCGCACCAAGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-1571s21c1
Sequence:CCGGCTGCGAGATCAACGACCAGAACTCGAGTTCTGGTCGTTGATCTCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000681.2-3065s1c1
Sequence:CCGGGCCCTGTGTATAAAGCCATTACTCGAGTAATGGCTTTATACACAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000681.2-2091s1c1
Sequence:CCGGACGCACGCTCTTCAAATTCTTCTCGAGAAGAATTTGAAGAGCGTGCGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000681.3-2833s21c1
Sequence:CCGGCCGCTGTAAATATACACTATTCTCGAGAATAGTGTATATTTACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-1412s21c1
Sequence:CCGGCATCACACAGGCCATCGAGTACTCGAGTACTCGATGGCCTGTGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-2219s21c1
Sequence:CCGGGCCACGCACGCTCTTCAAATTCTCGAGAATTTGAAGAGCGTGCGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000681.2-1452s1c1
Sequence:CCGGCGACCAGAAGTGGTACGTCATCTCGAGATGACGTACCACTTCTGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1471s21c1
Sequence:CCGGTCATCACCGTGTGGGTCATCTCTCGAGAGATGACCCACACGGTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000681
VALIDATED
ADRA2A MISSION shRNA shRNA Plasmid DNA
adrenoceptor alpha 2A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1595s21c1
Sequence:CCGGGTACGTCATCTCGTCGTGCATCTCGAGATGCACGACGAGATGACGTACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000681.3-2738s21c1
Sequence:CCGGTTACCTAGCCCTGGCTAATTCCTCGAGGAATTAGCCAGGGCTAGGTAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1168s21c1
Sequence:CCGGTCGTCATCATCGCCGTGTTCACTCGAGTGAACACGGCGATGATGACGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1316s21c1
Sequence:CCGGCAAGGCTTGGTGCGAGATCTACTCGAGTAGATCTCGCACCAAGCCTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-1571s21c1
Sequence:CCGGCTGCGAGATCAACGACCAGAACTCGAGTTCTGGTCGTTGATCTCGCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000008065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000681.2-3065s1c1
Sequence:CCGGGCCCTGTGTATAAAGCCATTACTCGAGTAATGGCTTTATACACAGGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000008067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000681.2-2091s1c1
Sequence:CCGGACGCACGCTCTTCAAATTCTTCTCGAGAAGAATTTGAAGAGCGTGCGTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000681.3-2833s21c1
Sequence:CCGGCCGCTGTAAATATACACTATTCTCGAGAATAGTGTATATTTACAGCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-1412s21c1
Sequence:CCGGCATCACACAGGCCATCGAGTACTCGAGTACTCGATGGCCTGTGTGATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000378226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-2219s21c1
Sequence:CCGGGCCACGCACGCTCTTCAAATTCTCGAGAATTTGAAGAGCGTGCGTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000008066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000681.2-1452s1c1
Sequence:CCGGCGACCAGAAGTGGTACGTCATCTCGAGATGACGTACCACTTCTGGTCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000356619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1471s21c1
Sequence:CCGGTCATCACCGTGTGGGTCATCTCTCGAGAGATGACCCACACGGTGATGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000681
VALIDATED
ADRA2A MISSION shRNA Lentiviral Transduction Particles
adrenoceptor alpha 2A
Human
12 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000378152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1595s21c1
Sequence:CCGGGTACGTCATCTCGTCGTGCATCTCGAGATGCACGACGAGATGACGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000681.3-2738s21c1
Sequence:CCGGTTACCTAGCCCTGGCTAATTCCTCGAGGAATTAGCCAGGGCTAGGTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1168s21c1
Sequence:CCGGTCGTCATCATCGCCGTGTTCACTCGAGTGAACACGGCGATGATGACGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1316s21c1
Sequence:CCGGCAAGGCTTGGTGCGAGATCTACTCGAGTAGATCTCGCACCAAGCCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-1571s21c1
Sequence:CCGGCTGCGAGATCAACGACCAGAACTCGAGTTCTGGTCGTTGATCTCGCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000681.2-3065s1c1
Sequence:CCGGGCCCTGTGTATAAAGCCATTACTCGAGTAATGGCTTTATACACAGGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000681.2-2091s1c1
Sequence:CCGGACGCACGCTCTTCAAATTCTTCTCGAGAAGAATTTGAAGAGCGTGCGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000681.3-2833s21c1
Sequence:CCGGCCGCTGTAAATATACACTATTCTCGAGAATAGTGTATATTTACAGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-1412s21c1
Sequence:CCGGCATCACACAGGCCATCGAGTACTCGAGTACTCGATGGCCTGTGTGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_000681.3-2219s21c1
Sequence:CCGGGCCACGCACGCTCTTCAAATTCTCGAGAATTTGAAGAGCGTGCGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000681.2-1452s1c1
Sequence:CCGGCGACCAGAAGTGGTACGTCATCTCGAGATGACGTACCACTTCTGGTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000681.3-1471s21c1
Sequence:CCGGTCATCACCGTGTGGGTCATCTCTCGAGAGATGACCCACACGGTGATGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)