EMAIL THIS PAGE TO A FRIEND

ADRB1

adrenoceptor beta 1

238 Gene Product Result for
Synonyms: ADRB1R B1AR BETA1AR RHR
UniProtKB ID: P08588, B0LPE2, Q5T5Y4, Q9UKG7, Q9UKG8
Gene ID:
Human(153) Summary: The adrenergic receptors (subtypes alpha 1, alpha 2, beta 1, and beta 2) are a prototypic family of guanine nucleotide binding regulatory protein-coupled receptors that mediate the physiological effects of the hormone epinephrine and the neurotransmitter norepinephrine. Specific polymorphisms in this gene have been shown to affect the resting heart rate and can be involved in heart failure. [provided by RefSeq, Jul 2008]
Mouse(11554) adrenergic receptor, beta 1
Rat(24925) adrenoceptor beta 1
Zebrafish(557194) adrenergic receptor, beta 1
cow(281604) adrenergic, beta-1-, receptor
domestic cat(493971) adrenoceptor beta 1
dog(493972) adrenoceptor beta 1
chicken(101750705) adrenoceptor beta 1
chicken(101666317) adrenoceptor beta 1
chicken(428983) adrenoceptor beta 1
sheep(101118321) adrenoceptor beta 1
sheep(443528) adrenoceptor beta 1
domestic guinea pig(100379595) adrenergic receptor, beta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
C125 (±)-CGP-12177A ≥98% (HPLC), solid human pricing
E4642 (±)-Epinephrine hydrochloride human pricing
A0937 (±)-Norepinephrine (+)-bitartrate salt human pricing
02250 (−)-Epinephrine ≥97.0% (NT) human pricing
E4375 (−)-Epinephrine (+)-bitartrate salt solid human pricing
17809 (−)-Epinephrine (+)-bitartrate salt tested according to Ph Eur human pricing
I2760 (−)-Isoproterenol (+)-bitartrate salt powder human pricing
Y0000882 Adrenaline European Pharmacopoeia (EP) Reference Standard human pricing
BP003 Adrenaline acid tartrate British Pharmacopoeia (BP) Reference Standard human pricing
A0300000 Adrenaline tartrate European Pharmacopoeia (EP) Reference Standard human pricing
Y0000707 Adrenaline tartrate with impurity A European Pharmacopoeia (EP) Reference Standard human pricing
Y0000883 Adrenaline with impurity F European Pharmacopoeia (EP) Reference Standard human pricing
D0676 Dobutamine hydrochloride ≥98% human pricing
1224507 Dobutamine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
D2954000 Dobutamine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP674 Dobutamine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
H8502 Dopamine hydrochloride human pricing
PHR1090 Dopamine hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1225204 Dopamine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
43658 Dopamine hydrochloride certified reference material, TraceCERT® human pricing
D2960000 Dopamine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
56610 Dopamine hydrochloride puriss., ≥98.5% (AT) human pricing
BP468 Dopamine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
D-081 Dopamine hydrochloride solution 1.0 mg/mL in methanol with 5% 1 M HCl (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
1237000 Epinephrine bitartrate United States Pharmacopeia (USP) Reference Standard human pricing
PHR1509 Epinephrine Bitartrate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
I3639 Isoetharine mesylate salt human pricing
I5627 Isoprenaline hydrochloride human pricing
I0599990 Isoprenaline hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP205 Isoprenaline hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
1351005 Isoproterenol hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
74480 L-Norepinephrine hydrochloride ≥98.0% (sum of enantiomers, HPLC) human pricing
D9446 L-DOPS ≥98% (HPLC) human pricing
1539701 Pindolol United States Pharmacopeia (USP) Reference Standard human pricing
P1800000 Pindolol European Pharmacopoeia (EP) Reference Standard human pricing
D7815 R(−)-Denopamine ≥98% (HPLC), powder human pricing
T2528 Terbutaline hemisulfate salt human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
M5391 (±)-Metoprolol (+)-tartrate salt ≥98% (titration), powder human pricing
80337 (±)-Metoprolol (+)-tartrate salt analytical standard human pricing
P0884 (±)-Propranolol hydrochloride ≥99% (TLC), powder human pricing
40543 (±)-Propranolol hydrochloride analytical standard human pricing
S0278 (±)-Sotalol hydrochloride ≥98% (TLC), powder human pricing
39863 (±)-Sotalol hydrochloride analytical standard human pricing
A143 (S)-(−)-Atenolol powder human pricing
A3669 Acebutolol hydrochloride analytical standard human pricing
PHR1907 Acebutolol hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1000601 Acebutolol hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
A0040000 Acebutolol hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
PHR1909 Atenolol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1044403 Atenolol United States Pharmacopeia (USP) Reference Standard human pricing
A1340000 Atenolol European Pharmacopoeia (EP) Reference Standard human pricing
BP492 Atenolol British Pharmacopoeia (BP) Reference Standard human pricing
BP370 Atenolol impurity standard British Pharmacopoeia (BP) Reference Standard human pricing
A-072 Atenolol solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Y0001360 Betaxolol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
B5683 Betaxolol hydrochloride >98% (HPLC) human pricing
1069903 Betaxolol hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
B1103000 Betaxolol hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP686 Betaxolol hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
50787 Bisoprolol analytical standard human pricing
Y0000877 Bisoprolol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0000813 Bisoprolol for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
1075757 Bisoprolol fumarate United States Pharmacopeia (USP) Reference Standard human pricing
Y0000812 Bisoprolol fumarate European Pharmacopoeia (EP) Reference Standard human pricing
BP1058 Bisoprolol fumarate British Pharmacopoeia (BP) Reference Standard human pricing
B2185 Bisoprolol hemifumarate salt ≥98% (HPLC), solid human pricing
C3993 Carvedilol ≥98% (HPLC), solid human pricing
PHR1265 Carvedilol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1096622 Carvedilol United States Pharmacopeia (USP) Reference Standard human pricing
Y0001427 Carvedilol European Pharmacopoeia (EP) Reference Standard human pricing
Y0001426 Carvedilol for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
C231 CGP-20712A methanesulfonate salt solid, ≥98% (HPLC) human pricing
E8031 Esmolol hydrochloride ≥98% (HPLC), solid human pricing
1249701 Esmolol hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
L1011 Labetalol hydrochloride >98% (TLC), powder human pricing
1356654 Labetalol hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
L0050000 Labetalol hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
PHR1335 Labetalol Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1441298 Metoprolol succinate United States Pharmacopeia (USP) Reference Standard human pricing
1441301 Metoprolol tartrate United States Pharmacopeia (USP) Reference Standard human pricing
M1830000 Metoprolol tartrate European Pharmacopoeia (EP) Reference Standard human pricing
BP540 Metoprolol tartrate British Pharmacopoeia (BP) Reference Standard human pricing
PHR1076 Metoprolol Tartrate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
M-123 Metoprolol tartrate solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
N1892 Nadolol analytical standard human pricing
1449700 Nadolol United States Pharmacopeia (USP) Reference Standard human pricing
Y0000146 Nadolol European Pharmacopoeia (EP) Reference Standard human pricing
P0778 Pindolol ≥98% (TLC), powder human pricing
P4670 Propafenone hydrochloride human pricing
1570304 Propafenone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0000455 Propafenone hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
Y0002135 Propranolol for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1308 Propranolol hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1576005 Propranolol hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
P3500000 Propranolol hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
222984 Propranolol hydrochloride 99% human pricing
BP1196 Propranolol hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
P3600000 Propranolol hydrochloride for performance test European Pharmacopoeia (EP) Reference Standard human pricing
P-055 Propranolol hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
P152 S(–)-Pindolol solid human pricing
1617408 Sotalol hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
BP498 Sotalol hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
Y0001270 Timolol for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
1667406 Timolol maleate United States Pharmacopeia (USP) Reference Standard human pricing
T1450000 Timolol maleate European Pharmacopoeia (EP) Reference Standard human pricing
BP1046 Timolol maleate British Pharmacopoeia (BP) Reference Standard human pricing
T6394 Timolol maleate salt ≥98% (TLC), powder human pricing
E4250 (−)-Epinephrine human, rat pricing
A7257 (−)-Norepinephrine ≥98%, crystalline human, rat pricing
A7655 Atenolol ≥98% (TLC), powder human, rat pricing
C6305 Clozapine human, rat pricing
51330 Harmaline ≥95% human, rat pricing
E1635 (±)-Epinephrine ≥95% rat pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
P8688 (S)-(−)-Propranolol hydrochloride ≥98% (TLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000684 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000684 Rosetta Predictions human pricing
NM_012701 Rosetta Predictions rat pricing
NM_007419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017455 predicted 299
2 SASI_Hs01_00017456 predicted 316
3 SASI_Hs01_00017457 predicted 357
4 SASI_Hs01_00017458 predicted 1492
5 SASI_Hs01_00017459 predicted 287
6 SASI_Hs01_00017460 predicted 1494
7 SASI_Hs01_00017461 predicted 1495
8 SASI_Hs01_00017462 predicted 1457
9 SASI_Hs01_00017463 predicted 1487
10 SASI_Hs02_00303085 predicted 1239
11 SASI_Hs01_00017454 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042232 predicted 234
2 SASI_Rn01_00042233 predicted 315
3 SASI_Rn01_00042234 predicted 301
4 SASI_Rn01_00042235 predicted 368
5 SASI_Rn01_00042236 predicted 406
6 SASI_Rn01_00042237 predicted 368
7 SASI_Rn01_00042238 predicted 196
8 SASI_Rn01_00042239 predicted 394
9 SASI_Rn01_00042241 predicted 434
10 SASI_Rn02_00260015 predicted 416
11 SASI_Rn01_00042240 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090154 predicted 226
2 SASI_Mm01_00090155 predicted 927
3 SASI_Mm01_00090156 predicted 414
4 SASI_Mm01_00090157 predicted 940
5 SASI_Mm01_00090158 predicted 485
6 SASI_Mm01_00090159 predicted 729
7 SASI_Mm01_00090160 predicted 545
8 SASI_Mm01_00090161 predicted 297
9 SASI_Mm01_00090162 predicted 987
10 SASI_Mm01_00090163 predicted 317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007419
ADRB1 MISSION shRNA Bacterial Glycerol Stock
adrenoceptor beta 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-933s1c1
Sequence:CCGGGCTCAAGACACTGGGCATCATCTCGAGATGATGCCCAGTGTCTTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-471s1c1
Sequence:CCGGCCTCGCCATCACGTCGCCCTTCTCGAGAAGGGCGACGTGATGGCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-947s1c1
Sequence:CCGGGCATCATCATGGGTGTGTTCACTCGAGTGAACACACCCATGATGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-207s1c1
Sequence:CCGGTCTGCTCATCGTGGTGGGTAACTCGAGTTACCCACCACGATGAGCAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-642s1c1
Sequence:CCGGGTGCTGCGATTTCGTCACCAACTCGAGTTGGTGACGAAATCGCAGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007419.2-1033s21c1
Sequence:CCGGGATCGCCTCTTCGTCTTCTTCCTCGAGGAAGAAGACGAAGAGGCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007419.2-1566s21c1
Sequence:CCGGAGCCCACAGATCTATCGAATCCTCGAGGATTCGATAGATCTGTGGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007419.2-394s21c1
Sequence:CCGGGAGCTCTGGACTTCGGTAGATCTCGAGATCTACCGAAGTCCAGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007419
ADRB1 MISSION shRNA shRNA Plasmid DNA
adrenoceptor beta 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-933s1c1
Sequence:CCGGGCTCAAGACACTGGGCATCATCTCGAGATGATGCCCAGTGTCTTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-471s1c1
Sequence:CCGGCCTCGCCATCACGTCGCCCTTCTCGAGAAGGGCGACGTGATGGCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-947s1c1
Sequence:CCGGGCATCATCATGGGTGTGTTCACTCGAGTGAACACACCCATGATGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-207s1c1
Sequence:CCGGTCTGCTCATCGTGGTGGGTAACTCGAGTTACCCACCACGATGAGCAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-642s1c1
Sequence:CCGGGTGCTGCGATTTCGTCACCAACTCGAGTTGGTGACGAAATCGCAGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007419.2-1033s21c1
Sequence:CCGGGATCGCCTCTTCGTCTTCTTCCTCGAGGAAGAAGACGAAGAGGCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007419.2-1566s21c1
Sequence:CCGGAGCCCACAGATCTATCGAATCCTCGAGGATTCGATAGATCTGTGGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007419.2-394s21c1
Sequence:CCGGGAGCTCTGGACTTCGGTAGATCTCGAGATCTACCGAAGTCCAGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007419
ADRB1 MISSION shRNA Lentiviral Transduction Particles
adrenoceptor beta 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-933s1c1
Sequence:CCGGGCTCAAGACACTGGGCATCATCTCGAGATGATGCCCAGTGTCTTGAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-471s1c1
Sequence:CCGGCCTCGCCATCACGTCGCCCTTCTCGAGAAGGGCGACGTGATGGCGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-947s1c1
Sequence:CCGGGCATCATCATGGGTGTGTTCACTCGAGTGAACACACCCATGATGATGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-207s1c1
Sequence:CCGGTCTGCTCATCGTGGTGGGTAACTCGAGTTACCCACCACGATGAGCAGATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000012205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007419.1-642s1c1
Sequence:CCGGGTGCTGCGATTTCGTCACCAACTCGAGTTGGTGACGAAATCGCAGCACTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000412274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007419.2-1033s21c1
Sequence:CCGGGATCGCCTCTTCGTCTTCTTCCTCGAGGAAGAAGACGAAGAGGCGATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000432973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007419.2-1566s21c1
Sequence:CCGGAGCCCACAGATCTATCGAATCCTCGAGGATTCGATAGATCTGTGGGCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000421840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007419.2-394s21c1
Sequence:CCGGGAGCTCTGGACTTCGGTAGATCTCGAGATCTACCGAAGTCCAGAGCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000684
ADRB1 MISSION shRNA Bacterial Glycerol Stock
adrenoceptor beta 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000684.1-1563s1c1
Sequence:CCGGGAACGAGGAGATCTGTGTTTACTCGAGTAAACACAGATCTCCTCGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000684.2-767s21c1
Sequence:CCGGCTCGTCCGTAGTCTCCTTCTACTCGAGTAGAAGGAGACTACGGACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000684.2-1804s21c1
Sequence:CCGGTGTGCGTGTGATGCATCTTTACTCGAGTAAAGATGCATCACACGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-557s1c1
Sequence:CCGGCCTCGCCATCACCTCGCCCTTCTCGAGAAGGGCGAGGTGATGGCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-1028s1c1
Sequence:CCGGCGTGGCCCTACGCGAGCAGAACTCGAGTTCTGCTCGCGTAGGGCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-359s1c1
Sequence:CCGGGCTCACCAACCTCTTCATCATCTCGAGATGATGAAGAGGTTGGTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-1499s1c1
Sequence:CCGGCGCCTCGGAATCCAAGGTGTACTCGAGTACACCTTGGATTCCGAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000684.2-797s21c1
Sequence:CCGGGTGCATCATGGCCTTCGTGTACTCGAGTACACGAAGGCCATGATGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000684.2-1995s21c1
Sequence:CCGGACAGTTTGTCAAGACATATTTCTCGAGAAATATGTCTTGACAAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000684
ADRB1 MISSION shRNA shRNA Plasmid DNA
adrenoceptor beta 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000684.1-1563s1c1
Sequence:CCGGGAACGAGGAGATCTGTGTTTACTCGAGTAAACACAGATCTCCTCGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000684.2-767s21c1
Sequence:CCGGCTCGTCCGTAGTCTCCTTCTACTCGAGTAGAAGGAGACTACGGACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000684.2-1804s21c1
Sequence:CCGGTGTGCGTGTGATGCATCTTTACTCGAGTAAAGATGCATCACACGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-557s1c1
Sequence:CCGGCCTCGCCATCACCTCGCCCTTCTCGAGAAGGGCGAGGTGATGGCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-1028s1c1
Sequence:CCGGCGTGGCCCTACGCGAGCAGAACTCGAGTTCTGCTCGCGTAGGGCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-359s1c1
Sequence:CCGGGCTCACCAACCTCTTCATCATCTCGAGATGATGAAGAGGTTGGTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-1499s1c1
Sequence:CCGGCGCCTCGGAATCCAAGGTGTACTCGAGTACACCTTGGATTCCGAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000684.2-797s21c1
Sequence:CCGGGTGCATCATGGCCTTCGTGTACTCGAGTACACGAAGGCCATGATGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000684.2-1995s21c1
Sequence:CCGGACAGTTTGTCAAGACATATTTCTCGAGAAATATGTCTTGACAAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000684
ADRB1 MISSION shRNA Lentiviral Transduction Particles
adrenoceptor beta 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000684.1-1563s1c1
Sequence:CCGGGAACGAGGAGATCTGTGTTTACTCGAGTAAACACAGATCTCCTCGTTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000684.2-767s21c1
Sequence:CCGGCTCGTCCGTAGTCTCCTTCTACTCGAGTAGAAGGAGACTACGGACGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000378230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000684.2-1804s21c1
Sequence:CCGGTGTGCGTGTGATGCATCTTTACTCGAGTAAAGATGCATCACACGCACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-557s1c1
Sequence:CCGGCCTCGCCATCACCTCGCCCTTCTCGAGAAGGGCGAGGTGATGGCGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-1028s1c1
Sequence:CCGGCGTGGCCCTACGCGAGCAGAACTCGAGTTCTGCTCGCGTAGGGCCACGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-359s1c1
Sequence:CCGGGCTCACCAACCTCTTCATCATCTCGAGATGATGAAGAGGTTGGTGAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000684.1-1499s1c1
Sequence:CCGGCGCCTCGGAATCCAAGGTGTACTCGAGTACACCTTGGATTCCGAGGCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000378103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000684.2-797s21c1
Sequence:CCGGGTGCATCATGGCCTTCGTGTACTCGAGTACACGAAGGCCATGATGCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000684.2-1995s21c1
Sequence:CCGGACAGTTTGTCAAGACATATTTCTCGAGAAATATGTCTTGACAAACTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???