EMAIL THIS PAGE TO A FRIEND

ADRB2

adrenoceptor beta 2, surface

190 Gene Product Result for
Synonyms: ADRB2R ADRBR B2AR BAR BETA2AR
Gene ID:
Human(154) Summary: This gene encodes beta-2-adrenergic receptor which is a member of the G protein-coupled receptor superfamily. This receptor is directly associated with one of its ultimate effectors, the class C L-type calcium channel Ca(V)1.2. This receptor-channel complex also contains a G protein, an adenylyl cyclase, cAMP-dependent kinase, and the counterbalancing phosphatase, PP2A. The assembly of the signaling complex provides a mechanism that ensures specific and rapid signaling by this G protein-coupled receptor. This gene is intronless. Different polymorphic forms, point mutations, and/or downregulation of this gene are associated with nocturnal asthma, obesity and type 2 diabetes. [provided by RefSeq, Jul 2008]
Mouse(11555) adrenergic receptor, beta 2
Rat(24176) adrenoceptor beta 2, surface
domestic guinea pig(100722663) adrenoceptor beta 2, surface
naked mole-rat(101708921) adrenoceptor beta 2, surface
sheep(100170320) adrenoceptor beta 2, surface
Domestic Rabbit(100340821) adrenoceptor beta 2, surface
chicken(427623) adrenergic, beta-2-, receptor, surface
domestic cat(493767) adrenoceptor beta 2, surface
cow(281605) adrenergic, beta-2-, receptor, surface
Horse(100060659) adrenoceptor beta 2, surface
dog(403910) adrenoceptor beta 2, surface
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405433 Anti-ADRB2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
flow cytometry, western blot pricing
HPA003431 Anti-ADRB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4500577 Anti-ADRB2 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, western blot pricing
SAB4500578 Anti-ADRB2 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing
SAB2100065 Anti-ADRB2 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2500035 Anti-ADRB2R/ADRB2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB4500576 Anti-Adrenergic Receptor β2 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AB9410 Anti-Adrenoceptor β-2 Antibody clone, Chemicon®, from rabbit human
immunohistochemistry pricing
GW21011 Anti-β-2 Adrenergic Receptor antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
A4729 Anti-β2 Adrenergic Receptor antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunocytochemistry, immunohistochemistry pricing
SAB4301467 Anti-phospho-Adrenergic Receptor β2 (pSer346) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504074 Anti-phospho-Adrenergic Receptor B2 (pSer355+Ser356) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
C125 (±)-CGP-12177A ≥98% (HPLC), solid human pricing
E4642 (±)-Epinephrine hydrochloride human pricing
A0937 (±)-Norepinephrine (+)-bitartrate salt human pricing
02250 (−)-Epinephrine ≥97.0% (NT) human pricing
E4375 (−)-Epinephrine (+)-bitartrate salt solid human pricing
17809 (−)-Epinephrine (+)-bitartrate salt tested according to Ph. Eur. human pricing
I2760 (−)-Isoproterenol (+)-bitartrate salt powder human pricing
I6504 (−)-Isoproterenol hydrochloride human pricing
Y0000882 Adrenaline European Pharmacopoeia (EP) Reference Standard human pricing
BP003 Adrenaline acid tartrate British Pharmacopoeia (BP) Reference Standard human pricing
A0300000 Adrenaline tartrate European Pharmacopoeia (EP) Reference Standard human pricing
Y0000707 Adrenaline tartrate with impurity A European Pharmacopoeia (EP) Reference Standard human pricing
Y0000883 Adrenaline with impurity F European Pharmacopoeia (EP) Reference Standard human pricing
1012600 Albuterol United States Pharmacopeia (USP) Reference Standard human pricing
PHR1053 Albuterol sulfate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1012633 Albuterol sulfate United States Pharmacopeia (USP) Reference Standard human pricing
C5423 Clenbuterol hydrochloride ≥95% human pricing
1134674 Clenbuterol hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C2248000 Clenbuterol hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C-080 Clenbuterol hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
D0676 Dobutamine hydrochloride ≥98% human pricing
1224507 Dobutamine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
D2954000 Dobutamine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
BP674 Dobutamine hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
1237000 Epinephrine bitartrate United States Pharmacopeia (USP) Reference Standard human pricing
PHR1509 Epinephrine Bitartrate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
32376 erythro-Isoxsuprine hydrochloride VETRANAL®, analytical standard human pricing
Y0000756 Fenoterol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
Y0002102 Fenoterol for system suitability, European Pharmacopoeia (EP) Reference Standard human pricing
F1016 Fenoterol hydrobromide human pricing
BP660 Fenoterol hydrobromide British Pharmacopoeia (BP) Reference Standard human pricing
F0050000 Fenoterol hydrobromide European Pharmacopoeia (EP) Reference Standard human pricing
F9552 Formoterol fumarate dihydrate >98% (HPLC) human pricing
I3639 Isoetharine mesylate salt human pricing
I5627 Isoprenaline hydrochloride human pricing
BP205 Isoprenaline hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
I0599990 Isoprenaline hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1351005 Isoproterenol hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
I0880 Isoxsuprine hydrochloride analytical standard human pricing
I0900000 Isoxsuprine hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
1354003 Isoxsuprine hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
74480 L-Norepinephrine hydrochloride ≥98.0% (sum of enantiomers, HPLC) human pricing
D9446 L-DOPS ≥98% (HPLC) human pricing
SML0138 Levalbuterol hydrochloride ≥98% (HPLC) human pricing
1358784 Levalbuterol hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M2398 Metaproterenol hemisulfate salt human pricing
1395500 Metaproterenol sulfate United States Pharmacopeia (USP) Reference Standard human pricing
Y0000895 Orciprenaline for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
O0180000 Orciprenaline sulfate European Pharmacopoeia (EP) Reference Standard human pricing
P0778 Pindolol ≥98% (TLC), powder human pricing
P1800000 Pindolol European Pharmacopoeia (EP) Reference Standard human pricing
1539701 Pindolol United States Pharmacopeia (USP) Reference Standard human pricing
32142 Pirbuterol acetate VETRANAL®, analytical standard human pricing
1544304 Pirbuterol acetate United States Pharmacopeia (USP) Reference Standard human pricing
R0758 Ritodrine hydrochloride human pricing
S8260 Salbutamol human pricing
46725 Salbutamol VETRANAL®, analytical standard human pricing
S0100000 Salbutamol European Pharmacopoeia (EP) Reference Standard human pricing
BP451 Salbutamol British Pharmacopoeia (BP) Reference Standard human pricing
S5013 Salbutamol hemisulfate salt ≥98% human pricing
46732 Salbutamol hemisulfate salt VETRANAL®, analytical standard human pricing
S0150000 Salbutamol sulfate European Pharmacopoeia (EP) Reference Standard human pricing
BP302 Salbutamol sulfate British Pharmacopoeia (BP) Reference Standard human pricing
Y0001288 Salbutamol sulfate for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
S5068 Salmeterol xinafoate ≥98% (HPLC), solid human pricing
Y0000422 Salmeterol xinafoate European Pharmacopoeia (EP) Reference Standard human pricing
BP1181 Salmeterol xinafoate British Pharmacopoeia (BP) Reference Standard human pricing
1609603 Salmeterol xinafoate United States Pharmacopeia (USP) Reference Standard human pricing
PHR1947 Salmeterol Xinafoate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0000423 Salmeterol xinafoate for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
T2528 Terbutaline hemisulfate salt human pricing
T0050000 Terbutaline sulfate European Pharmacopoeia (EP) Reference Standard human pricing
BP318 Terbutaline sulfate British Pharmacopoeia (BP) Reference Standard human pricing
1643500 Terbutaline sulfate United States Pharmacopeia (USP) Reference Standard human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P0884 (±)-Propranolol hydrochloride ≥99% (TLC), powder human pricing
40543 (±)-Propranolol hydrochloride analytical standard human pricing
S0278 (±)-Sotalol hydrochloride ≥98% (TLC), powder human pricing
39863 (±)-Sotalol hydrochloride analytical standard human pricing
C3993 Carvedilol ≥98% (HPLC), solid human pricing
PHR1265 Carvedilol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1096622 Carvedilol United States Pharmacopeia (USP) Reference Standard human pricing
Y0001427 Carvedilol European Pharmacopoeia (EP) Reference Standard human pricing
Y0001426 Carvedilol for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
1249701 Esmolol hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
E8031 Esmolol hydrochloride ≥98% (HPLC), solid human pricing
I127 ICI 118,551 hydrochloride ≥98% (HPLC), powder human pricing
L1011 Labetalol hydrochloride >98% (TLC), powder human pricing
1356654 Labetalol hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
L0050000 Labetalol hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
PHR1335 Labetalol Hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
M7065 MK-912 hydrochloride hydrate ≥98% (HPLC) human pricing
N1892 Nadolol analytical standard human pricing
1449700 Nadolol United States Pharmacopeia (USP) Reference Standard human pricing
Y0000146 Nadolol European Pharmacopoeia (EP) Reference Standard human pricing
P4670 Propafenone hydrochloride human pricing
1570304 Propafenone hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
Y0000455 Propafenone hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
Y0002135 Propranolol for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1308 Propranolol hydrochloride Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1576005 Propranolol hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
BP1196 Propranolol hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
P3500000 Propranolol hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
222984 Propranolol hydrochloride 99% human pricing
P3600000 Propranolol hydrochloride for performance test European Pharmacopoeia (EP) Reference Standard human pricing
P-055 Propranolol hydrochloride solution 1.0 mg/mL in methanol (as free base), ampule of 1 mL, certified reference material, Cerilliant® human pricing
1617408 Sotalol hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
BP498 Sotalol hydrochloride British Pharmacopoeia (BP) Reference Standard human pricing
Y0001270 Timolol for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
1667406 Timolol maleate United States Pharmacopeia (USP) Reference Standard human pricing
T1450000 Timolol maleate European Pharmacopoeia (EP) Reference Standard human pricing
BP1046 Timolol maleate British Pharmacopoeia (BP) Reference Standard human pricing
T6394 Timolol maleate salt ≥98% (TLC), powder human pricing
E4250 (−)-Epinephrine human, rat pricing
A7257 (−)-Norepinephrine ≥98%, crystalline human, rat pricing
51330 Harmaline ≥95% human, rat pricing
E1635 (±)-Epinephrine ≥95% rat pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
P8688 (S)-(−)-Propranolol hydrochloride ≥98% (TLC), powder human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0744 AQUA Peptide YQSLLT[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000024 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000024 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000024 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000024 Rosetta Predictions human pricing
NM_012492 Rosetta Predictions rat pricing
NM_007420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209061 predicted 634
2 SASI_Hs01_00209062 predicted 771
3 SASI_Hs01_00209063 predicted 736
4 SASI_Hs01_00209064 predicted 1226
5 SASI_Hs01_00209066 predicted 1160
6 SASI_Hs01_00209067 predicted 869
7 SASI_Hs01_00209068 predicted 1049
8 SASI_Hs02_00301687 predicted 781
9 SASI_Hs01_00209069 predicted 685
10 SASI_Hs02_00301688 predicted 639
11 SASI_Hs01_00209060 predicted 1140
12 SASI_Hs01_00209065 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012492 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101905 predicted 980
2 SASI_Rn02_00259525 predicted 790
3 SASI_Rn02_00259526 predicted 203
4 SASI_Rn01_00101907 predicted 373
5 SASI_Rn01_00101908 predicted 1164
6 SASI_Rn01_00101909 predicted 900
7 SASI_Rn02_00259527 predicted 995
8 SASI_Rn01_00101911 predicted 652
9 SASI_Rn01_00101912 predicted 1008
10 SASI_Rn01_00101913 predicted 370
11 SASI_Rn01_00101906 predicted 361
12 SASI_Rn01_00101910 predicted 1113
13 SASI_Rn01_00101914 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154297 predicted 374
2 SASI_Mm01_00154298 predicted 1173
3 SASI_Mm01_00154299 predicted 224
4 SASI_Mm01_00154300 predicted 1127
5 SASI_Mm01_00154301 predicted 1011
6 SASI_Mm01_00154302 predicted 1115
7 SASI_Mm01_00154303 predicted 1016
8 SASI_Mm01_00154304 predicted 380
9 SASI_Mm01_00154305 predicted 916
10 SASI_Mm01_00154306 predicted 733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007420
ADRB2 MISSION shRNA Bacterial Glycerol Stock
adrenoceptor beta 2, surface
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007420.2-1445s21c1
Sequence:CCGGCAAATGACTCGCCACTGTAATCTCGAGATTACAGTGGCGAGTCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007420.2-1639s21c1
Sequence:CCGGACTGTATTTGAGTGCTTATTGCTCGAGCAATAAGCACTCAAATACAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007420.2-1080s21c1
Sequence:CCGGTGTCAATATCGTGCACGTTATCTCGAGATAACGTGCACGATATTGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-1110s1c1
Sequence:CCGGCCTCATCCCTAAGGAAGTTTACTCGAGTAAACTTCCTTAGGGATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-737s1c1
Sequence:CCGGCCCACAAGAAAGCTATCGATTCTCGAGAATCGATAGCTTTCTTGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-478s1c1
Sequence:CCGGGCCAGTCACATCCTTATGAAACTCGAGTTTCATAAGGATGTGACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-1263s1c1
Sequence:CCGGCGGCTACTCTAGCAATAGCAACTCGAGTTGCTATTGCTAGAGTAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007420.2-1680s1c1
Sequence:CCGGCCTCTTTGTATGGAACTTAAACTCGAGTTTAAGTTCCATACAAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007420
ADRB2 MISSION shRNA shRNA Plasmid DNA
adrenoceptor beta 2, surface
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007420.2-1445s21c1
Sequence:CCGGCAAATGACTCGCCACTGTAATCTCGAGATTACAGTGGCGAGTCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007420.2-1639s21c1
Sequence:CCGGACTGTATTTGAGTGCTTATTGCTCGAGCAATAAGCACTCAAATACAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007420.2-1080s21c1
Sequence:CCGGTGTCAATATCGTGCACGTTATCTCGAGATAACGTGCACGATATTGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-1110s1c1
Sequence:CCGGCCTCATCCCTAAGGAAGTTTACTCGAGTAAACTTCCTTAGGGATGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-737s1c1
Sequence:CCGGCCCACAAGAAAGCTATCGATTCTCGAGAATCGATAGCTTTCTTGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-478s1c1
Sequence:CCGGGCCAGTCACATCCTTATGAAACTCGAGTTTCATAAGGATGTGACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-1263s1c1
Sequence:CCGGCGGCTACTCTAGCAATAGCAACTCGAGTTGCTATTGCTAGAGTAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007420.2-1680s1c1
Sequence:CCGGCCTCTTTGTATGGAACTTAAACTCGAGTTTAAGTTCCATACAAAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007420
ADRB2 MISSION shRNA Lentiviral Transduction Particles
adrenoceptor beta 2, surface
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007420.2-1445s21c1
Sequence:CCGGCAAATGACTCGCCACTGTAATCTCGAGATTACAGTGGCGAGTCATTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000414086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007420.2-1639s21c1
Sequence:CCGGACTGTATTTGAGTGCTTATTGCTCGAGCAATAAGCACTCAAATACAGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000412379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007420.2-1080s21c1
Sequence:CCGGTGTCAATATCGTGCACGTTATCTCGAGATAACGTGCACGATATTGACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-1110s1c1
Sequence:CCGGCCTCATCCCTAAGGAAGTTTACTCGAGTAAACTTCCTTAGGGATGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-737s1c1
Sequence:CCGGCCCACAAGAAAGCTATCGATTCTCGAGAATCGATAGCTTTCTTGTGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-478s1c1
Sequence:CCGGGCCAGTCACATCCTTATGAAACTCGAGTTTCATAAGGATGTGACTGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007420.2-1263s1c1
Sequence:CCGGCGGCTACTCTAGCAATAGCAACTCGAGTTGCTATTGCTAGAGTAGCCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007420.2-1680s1c1
Sequence:CCGGCCTCTTTGTATGGAACTTAAACTCGAGTTTAAGTTCCATACAAAGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000024
ADRB2 MISSION shRNA Bacterial Glycerol Stock
adrenoceptor beta 2, surface
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000024.4-1741s21c1
Sequence:CCGGGGACCTGAGTCTGCTATATTTCTCGAGAAATATAGCAGACTCAGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000024.4-1412s21c1
Sequence:CCGGAGGTACTGTGCCTAGCGATAACTCGAGTTATCGCTAGGCACAGTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000024.3-1673s1c1
Sequence:CCGGCCTCTTTGCATGGAATTTGTACTCGAGTACAAATTCCATGCAAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000024.4-1520s21c1
Sequence:CCGGGAACACTAAACAGACTATTTACTCGAGTAAATAGTCTGTTTAGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000024.4-619s21c1
Sequence:CCGGTCGCAGTGGATCGCTACTTTGCTCGAGCAAAGTAGCGATCCACTGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1032s1c1
Sequence:CCGGCCTCAAGACGTTAGGCATCATCTCGAGATGATGCCTAACGTCTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1146s1c1
Sequence:CCGGCCTCCTAAATTGGATAGGCTACTCGAGTAGCCTATCCAATTTAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1206s1c1
Sequence:CCGGCCCAGATTTCAGGATTGCCTTCTCGAGAAGGCAATCCTGAAATCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-760s1c1
Sequence:CCGGGCCATCAACTGCTATGCCAATCTCGAGATTGGCATAGCAGTTGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000024
ADRB2 MISSION shRNA shRNA Plasmid DNA
adrenoceptor beta 2, surface
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000024.4-1741s21c1
Sequence:CCGGGGACCTGAGTCTGCTATATTTCTCGAGAAATATAGCAGACTCAGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000024.4-1412s21c1
Sequence:CCGGAGGTACTGTGCCTAGCGATAACTCGAGTTATCGCTAGGCACAGTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000024.3-1673s1c1
Sequence:CCGGCCTCTTTGCATGGAATTTGTACTCGAGTACAAATTCCATGCAAAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000024.4-1520s21c1
Sequence:CCGGGAACACTAAACAGACTATTTACTCGAGTAAATAGTCTGTTTAGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000024.4-619s21c1
Sequence:CCGGTCGCAGTGGATCGCTACTTTGCTCGAGCAAAGTAGCGATCCACTGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1032s1c1
Sequence:CCGGCCTCAAGACGTTAGGCATCATCTCGAGATGATGCCTAACGTCTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1146s1c1
Sequence:CCGGCCTCCTAAATTGGATAGGCTACTCGAGTAGCCTATCCAATTTAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1206s1c1
Sequence:CCGGCCCAGATTTCAGGATTGCCTTCTCGAGAAGGCAATCCTGAAATCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-760s1c1
Sequence:CCGGGCCATCAACTGCTATGCCAATCTCGAGATTGGCATAGCAGTTGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000024
ADRB2 MISSION shRNA Lentiviral Transduction Particles
adrenoceptor beta 2, surface
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000024.4-1741s21c1
Sequence:CCGGGGACCTGAGTCTGCTATATTTCTCGAGAAATATAGCAGACTCAGGTCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000024.4-1412s21c1
Sequence:CCGGAGGTACTGTGCCTAGCGATAACTCGAGTTATCGCTAGGCACAGTACCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000024.3-1673s1c1
Sequence:CCGGCCTCTTTGCATGGAATTTGTACTCGAGTACAAATTCCATGCAAAGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000356689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000024.4-1520s21c1
Sequence:CCGGGAACACTAAACAGACTATTTACTCGAGTAAATAGTCTGTTTAGTGTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000378218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000024.4-619s21c1
Sequence:CCGGTCGCAGTGGATCGCTACTTTGCTCGAGCAAAGTAGCGATCCACTGCGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1032s1c1
Sequence:CCGGCCTCAAGACGTTAGGCATCATCTCGAGATGATGCCTAACGTCTTGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1146s1c1
Sequence:CCGGCCTCCTAAATTGGATAGGCTACTCGAGTAGCCTATCCAATTTAGGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000011229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-1206s1c1
Sequence:CCGGCCCAGATTTCAGGATTGCCTTCTCGAGAAGGCAATCCTGAAATCTGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000024.3-760s1c1
Sequence:CCGGGCCATCAACTGCTATGCCAATCTCGAGATTGGCATAGCAGTTGATGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???