EMAIL THIS PAGE TO A FRIEND

ADSS

adenylosuccinate synthase

121 Gene Product Result for
Synonyms: ADEH ADSS 2
UniProtKB ID: P30520, B1AQM5, Q96EG7
Gene ID:
Human(159) Summary: This gene encodes the enzyme adenylosuccinate synthetase which catalyzes the first committed step in the conversion of inosine monophosphate to adenosine monophosphate. A pseudogene of this gene is found on chromosome 17.[provided by RefSeq, Nov 2010]
Mouse(11566) adenylosuccinate synthetase, non muscle
Rat(289276) adenylosuccinate synthase
Zebrafish(550502) adenylosuccinate synthase
cow(522529) adenylosuccinate synthase
domestic cat(101092076) adenylosuccinate synthase
dog(480098) adenylosuccinate synthase
chicken(428579) adenylosuccinate synthase
Thale Cress(824930) adenylosuccinate synthetase
sheep(101107881) adenylosuccinate synthase
domestic guinea pig(100725405) adenylosuccinate synthase
naked mole-rat(101697507) adenylosuccinate synthase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007422 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007422 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007422 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001126 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001126 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001126 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126 Rosetta Predictions human pricing
NM_001105975 Rosetta Predictions rat pricing
NM_007422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092767 predicted 1368
2 SASI_Hs01_00092768 predicted 1419
3 SASI_Hs01_00092769 predicted 1632
4 SASI_Hs01_00092770 predicted 491
5 SASI_Hs01_00092772 predicted 1525
6 SASI_Hs02_00327986 predicted 738
7 SASI_Hs01_00092773 predicted 1594
8 SASI_Hs01_00092774 predicted 1401
9 SASI_Hs01_00092775 predicted 1605
10 SASI_Hs01_00092776 predicted 1161
11 SASI_Hs01_00092771 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214392 predicted 1499
2 SASI_Rn02_00214393 predicted 1350
3 SASI_Rn02_00214394 predicted 1302
4 SASI_Rn02_00214395 predicted 733
5 SASI_Rn02_00214396 predicted 890
6 SASI_Rn02_00214397 predicted 1423
7 SASI_Rn02_00214398 predicted 998
8 SASI_Rn02_00214399 predicted 912
9 SASI_Rn02_00214400 predicted 1186
10 SASI_Rn02_00214401 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071253 predicted 1160
2 SASI_Mm01_00071254 predicted 1425
3 SASI_Mm01_00071255 predicted 986
4 SASI_Mm01_00071256 predicted 1350
5 SASI_Mm01_00071257 predicted 330
6 SASI_Mm02_00311566 predicted 857
7 SASI_Mm01_00071259 predicted 702
8 SASI_Mm01_00071262 predicted 1395
9 SASI_Mm02_00311567 predicted 1189
10 SASI_Mm02_00311568 predicted 1420
11 SASI_Mm01_00071258 predicted 1472
12 SASI_Mm01_00071260 predicted 404
13 SASI_Mm01_00071261 predicted 1006
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007422
VALIDATED
ADSS MISSION shRNA Bacterial Glycerol Stock
adenylosuccinate synthase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007422.2-2142s1c1
Sequence:CCGGCCCTACAATAACAACCTTAATCTCGAGATTAAGGTTGTTATTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007422.2-512s1c1
Sequence:CCGGGCTCATATTGTGTTTGACTTTCTCGAGAAAGTCAAACACAATATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007422.2-1403s1c1
Sequence:CCGGCGGTTTATTGAAGATGAGCTTCTCGAGAAGCTCATCTTCAATAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007422.2-804s1c1
Sequence:CCGGTGGTGAAAGATGGAGTTTATTCTCGAGAATAAACTCCATCTTTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007422.2-801s1c1
Sequence:CCGGCGATGGTGAAAGATGGAGTTTCTCGAGAAACTCCATCTTTCACCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007422.3-2142s21c6
Sequence:CCGGCCCTACAATAACAACCTTAATCTCGAGATTAAGGTTGTTATTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007422.3-1403s21c2
Sequence:CCGGCGGTTTATTGAAGATGAGCTTCTCGAGAAGCTCATCTTCAATAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007422.3-512s21c1
Sequence:CCGGGCTCATATTGTGTTTGACTTTCTCGAGAAAGTCAAACACAATATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007422.3-804s21c3
Sequence:CCGGTGGTGAAAGATGGAGTTTATTCTCGAGAATAAACTCCATCTTTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007422
VALIDATED
ADSS MISSION shRNA shRNA Plasmid DNA
adenylosuccinate synthase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007422.2-2142s1c1
Sequence:CCGGCCCTACAATAACAACCTTAATCTCGAGATTAAGGTTGTTATTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007422.2-512s1c1
Sequence:CCGGGCTCATATTGTGTTTGACTTTCTCGAGAAAGTCAAACACAATATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007422.2-1403s1c1
Sequence:CCGGCGGTTTATTGAAGATGAGCTTCTCGAGAAGCTCATCTTCAATAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007422.2-804s1c1
Sequence:CCGGTGGTGAAAGATGGAGTTTATTCTCGAGAATAAACTCCATCTTTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007422.2-801s1c1
Sequence:CCGGCGATGGTGAAAGATGGAGTTTCTCGAGAAACTCCATCTTTCACCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007422.3-2142s21c6
Sequence:CCGGCCCTACAATAACAACCTTAATCTCGAGATTAAGGTTGTTATTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007422.3-1403s21c2
Sequence:CCGGCGGTTTATTGAAGATGAGCTTCTCGAGAAGCTCATCTTCAATAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007422.3-512s21c1
Sequence:CCGGGCTCATATTGTGTTTGACTTTCTCGAGAAAGTCAAACACAATATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007422.3-804s21c3
Sequence:CCGGTGGTGAAAGATGGAGTTTATTCTCGAGAATAAACTCCATCTTTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007422
VALIDATED
ADSS MISSION shRNA Lentiviral Transduction Particles
adenylosuccinate synthase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007422.2-2142s1c1
Sequence:CCGGCCCTACAATAACAACCTTAATCTCGAGATTAAGGTTGTTATTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007422.2-512s1c1
Sequence:CCGGGCTCATATTGTGTTTGACTTTCTCGAGAAAGTCAAACACAATATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007422.2-1403s1c1
Sequence:CCGGCGGTTTATTGAAGATGAGCTTCTCGAGAAGCTCATCTTCAATAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007422.2-804s1c1
Sequence:CCGGTGGTGAAAGATGGAGTTTATTCTCGAGAATAAACTCCATCTTTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007422.2-801s1c1
Sequence:CCGGCGATGGTGAAAGATGGAGTTTCTCGAGAAACTCCATCTTTCACCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007422.3-2142s21c6
Sequence:CCGGCCCTACAATAACAACCTTAATCTCGAGATTAAGGTTGTTATTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007422.3-1403s21c2
Sequence:CCGGCGGTTTATTGAAGATGAGCTTCTCGAGAAGCTCATCTTCAATAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007422.3-512s21c1
Sequence:CCGGGCTCATATTGTGTTTGACTTTCTCGAGAAAGTCAAACACAATATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007422.3-804s21c3
Sequence:CCGGTGGTGAAAGATGGAGTTTATTCTCGAGAATAAACTCCATCTTTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001126
VALIDATED
ADSS MISSION shRNA Bacterial Glycerol Stock
adenylosuccinate synthase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001126.2-1060s1c1
Sequence:CCGGGCAGCACTATTAGATATTGATCTCGAGATCAATATCTAATAGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001126.2-1339s1c1
Sequence:CCGGGCTCATATGATCAATGGATTTCTCGAGAAATCCATTGATCATATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001126.2-494s1c1
Sequence:CCGGGCCATACAGTTGTTGTGGATTCTCGAGAATCCACAACAACTGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001126.2-1423s1c1
Sequence:CCGGGCTTACAAGTTAGATGGTGAACTCGAGTTCACCATCTAACTTGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001126.2-1543s1c1
Sequence:CCGGGCGTTTAAAGAACTACCTGTTCTCGAGAACAGGTAGTTCTTTAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001126.2-1423s21c1
Sequence:CCGGGCTTACAAGTTAGATGGTGAACTCGAGTTCACCATCTAACTTGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001126.2-494s21c1
Sequence:CCGGGCCATACAGTTGTTGTGGATTCTCGAGAATCCACAACAACTGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001126.2-1543s21c1
Sequence:CCGGGCGTTTAAAGAACTACCTGTTCTCGAGAACAGGTAGTTCTTTAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001126.2-1339s21c1
Sequence:CCGGGCTCATATGATCAATGGATTTCTCGAGAAATCCATTGATCATATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001126
VALIDATED
ADSS MISSION shRNA shRNA Plasmid DNA
adenylosuccinate synthase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001126.2-1060s1c1
Sequence:CCGGGCAGCACTATTAGATATTGATCTCGAGATCAATATCTAATAGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001126.2-1339s1c1
Sequence:CCGGGCTCATATGATCAATGGATTTCTCGAGAAATCCATTGATCATATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001126.2-494s1c1
Sequence:CCGGGCCATACAGTTGTTGTGGATTCTCGAGAATCCACAACAACTGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001126.2-1423s1c1
Sequence:CCGGGCTTACAAGTTAGATGGTGAACTCGAGTTCACCATCTAACTTGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001126.2-1543s1c1
Sequence:CCGGGCGTTTAAAGAACTACCTGTTCTCGAGAACAGGTAGTTCTTTAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001126.2-1423s21c1
Sequence:CCGGGCTTACAAGTTAGATGGTGAACTCGAGTTCACCATCTAACTTGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001126.2-494s21c1
Sequence:CCGGGCCATACAGTTGTTGTGGATTCTCGAGAATCCACAACAACTGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001126.2-1543s21c1
Sequence:CCGGGCGTTTAAAGAACTACCTGTTCTCGAGAACAGGTAGTTCTTTAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001126.2-1339s21c1
Sequence:CCGGGCTCATATGATCAATGGATTTCTCGAGAAATCCATTGATCATATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001126
VALIDATED
ADSS MISSION shRNA Lentiviral Transduction Particles
adenylosuccinate synthase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001126.2-1060s1c1
Sequence:CCGGGCAGCACTATTAGATATTGATCTCGAGATCAATATCTAATAGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001126.2-1339s1c1
Sequence:CCGGGCTCATATGATCAATGGATTTCTCGAGAAATCCATTGATCATATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001126.2-494s1c1
Sequence:CCGGGCCATACAGTTGTTGTGGATTCTCGAGAATCCACAACAACTGTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001126.2-1423s1c1
Sequence:CCGGGCTTACAAGTTAGATGGTGAACTCGAGTTCACCATCTAACTTGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001126.2-1543s1c1
Sequence:CCGGGCGTTTAAAGAACTACCTGTTCTCGAGAACAGGTAGTTCTTTAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001126.2-1423s21c1
Sequence:CCGGGCTTACAAGTTAGATGGTGAACTCGAGTTCACCATCTAACTTGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001126.2-494s21c1
Sequence:CCGGGCCATACAGTTGTTGTGGATTCTCGAGAATCCACAACAACTGTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001126.2-1543s21c1
Sequence:CCGGGCGTTTAAAGAACTACCTGTTCTCGAGAACAGGTAGTTCTTTAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001126.2-1339s21c1
Sequence:CCGGGCTCATATGATCAATGGATTTCTCGAGAAATCCATTGATCATATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)