EMAIL THIS PAGE TO A FRIEND

AF529169

14 Gene Product Result for
Species: Mouse AF529169(209743)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153509 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153509 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153509 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU022991 MISSION® esiRNA targeting mouse Af529169 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153509 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086932 predicted 668
2 SASI_Mm01_00086934 predicted 1417
3 SASI_Mm01_00086935 predicted 2490
4 SASI_Mm01_00086936 predicted 3037
5 SASI_Mm01_00086938 predicted 893
6 SASI_Mm01_00086940 predicted 1896
7 SASI_Mm01_00086941 predicted 2299
8 SASI_Mm02_00343255 predicted 2861
9 SASI_Mm02_00343256 predicted 1908
10 SASI_Mm02_00343257 predicted 1584
11 SASI_Mm01_00086933 predicted 2985
12 SASI_Mm01_00086937 predicted 1954
13 SASI_Mm01_00086939 predicted 1598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153509
AF529169 MISSION shRNA Bacterial Glycerol Stock
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153509.1-3036s1c1
Sequence:CCGGCCAGGCTATGATTCATTACTACTCGAGTAGTAATGAATCATAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153509.1-4063s1c1
Sequence:CCGGGCAGAGACAATGGTGACAATTCTCGAGAATTGTCACCATTGTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153509.2-2292s21c1
Sequence:CCGGGTCCTTGGGAAACTCAATAAACTCGAGTTTATTGAGTTTCCCAAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153509.1-2688s1c1
Sequence:CCGGGCCAATAACAAAGATTGGCATCTCGAGATGCCAATCTTTGTTATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153509.1-1237s1c1
Sequence:CCGGCCAGTTTGGTTGGTACAACTACTCGAGTAGTTGTACCAACCAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153509.1-1769s1c1
Sequence:CCGGCGAAGCAGTCAAGAAGTTTAACTCGAGTTAAACTTCTTGACTGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153509.2-3538s21c1
Sequence:CCGGGACGTTGACACAATGATTAAACTCGAGTTTAATCATTGTGTCAACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153509
AF529169 MISSION shRNA shRNA Plasmid DNA
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153509.1-3036s1c1
Sequence:CCGGCCAGGCTATGATTCATTACTACTCGAGTAGTAATGAATCATAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153509.1-4063s1c1
Sequence:CCGGGCAGAGACAATGGTGACAATTCTCGAGAATTGTCACCATTGTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153509.2-2292s21c1
Sequence:CCGGGTCCTTGGGAAACTCAATAAACTCGAGTTTATTGAGTTTCCCAAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153509.1-2688s1c1
Sequence:CCGGGCCAATAACAAAGATTGGCATCTCGAGATGCCAATCTTTGTTATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153509.1-1237s1c1
Sequence:CCGGCCAGTTTGGTTGGTACAACTACTCGAGTAGTTGTACCAACCAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153509.1-1769s1c1
Sequence:CCGGCGAAGCAGTCAAGAAGTTTAACTCGAGTTAAACTTCTTGACTGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153509.2-3538s21c1
Sequence:CCGGGACGTTGACACAATGATTAAACTCGAGTTTAATCATTGTGTCAACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153509
AF529169 MISSION shRNA Lentiviral Transduction Particles
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153509.1-3036s1c1
Sequence:CCGGCCAGGCTATGATTCATTACTACTCGAGTAGTAATGAATCATAGCCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000125399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153509.1-4063s1c1
Sequence:CCGGGCAGAGACAATGGTGACAATTCTCGAGAATTGTCACCATTGTCTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000424824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153509.2-2292s21c1
Sequence:CCGGGTCCTTGGGAAACTCAATAAACTCGAGTTTATTGAGTTTCCCAAGGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000125401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153509.1-2688s1c1
Sequence:CCGGGCCAATAACAAAGATTGGCATCTCGAGATGCCAATCTTTGTTATTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000125402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153509.1-1237s1c1
Sequence:CCGGCCAGTTTGGTTGGTACAACTACTCGAGTAGTTGTACCAACCAAACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000125403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153509.1-1769s1c1
Sequence:CCGGCGAAGCAGTCAAGAAGTTTAACTCGAGTTAAACTTCTTGACTGCTTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000434354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153509.2-3538s21c1
Sequence:CCGGGACGTTGACACAATGATTAAACTCGAGTTTAATCATTGTGTCAACGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???