EMAIL THIS PAGE TO A FRIEND

AGA

aspartylglucosaminidase

61 Gene Product Result for
Synonyms: AGU ASRG GA
Gene ID:
Human(175) Summary: Aspartylglucosaminidase is involved in the catabolism of N-linked oligosaccharides of glycoproteins. It cleaves asparagine from N-acetylglucosamines as one of the final steps in the lysosomal breakdown of glycoproteins. The lysosomal storage disease aspartylglycosaminuria is caused by a deficiency in the AGA enzyme. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Jan 2010]
Mouse(11593) aspartylglucosaminidase
Rat(290923) aspartylglucosaminidase
Zebrafish(566517) aspartylglucosaminidase
cow(511345) aspartylglucosaminidase
domestic cat(101086138) aspartylglucosaminidase
dog(475638) aspartylglucosaminidase
chicken(422558) aspartylglucosaminidase
naked mole-rat(101721618) aspartylglucosaminidase
domestic guinea pig(100724192) aspartylglucosaminidase
sheep(101106396) aspartylglucosaminidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000027 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000027 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000027 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_134151 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_134151 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_134151 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000027 Rosetta Predictions human pricing
NM_001031641 Rosetta Predictions rat pricing
NM_001005847 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139014 predicted 1030
2 SASI_Hs01_00139015 predicted 832
3 SASI_Hs01_00139017 predicted 708
4 SASI_Hs01_00139018 predicted 675
5 SASI_Hs01_00139019 predicted 1044
6 SASI_Hs01_00139020 predicted 350
7 SASI_Hs01_00139021 predicted 494
8 SASI_Hs01_00139022 predicted 963
9 SASI_Hs01_00139023 predicted 1171
10 SASI_Hs02_00301693 predicted 1183
11 SASI_Hs01_00139016 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031641 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092922 predicted 404
2 SASI_Rn02_00203573 predicted 497
3 SASI_Rn01_00092923 predicted 417
4 SASI_Rn01_00092924 predicted 602
5 SASI_Rn01_00092925 predicted 647
6 SASI_Rn01_00092927 predicted 615
7 SASI_Rn01_00092928 predicted 505
8 SASI_Rn01_00092929 predicted 916
9 SASI_Rn01_00092930 predicted 471
10 SASI_Rn01_00092931 predicted 435
11 SASI_Rn01_00092926 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061128 predicted 474
2 SASI_Mm01_00061129 predicted 677
3 SASI_Mm01_00061130 predicted 699
4 SASI_Mm01_00061131 predicted 732
5 SASI_Mm01_00061132 predicted 857
6 SASI_Mm01_00061133 predicted 687
7 SASI_Mm01_00061135 predicted 472
8 SASI_Mm01_00061137 predicted 276
9 SASI_Mm02_00286658 predicted 530
10 SASI_Mm02_00286659 predicted 408
11 SASI_Mm01_00061134 predicted 542
12 SASI_Mm01_00061136 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000027
AGA MISSION shRNA Bacterial Glycerol Stock
aspartylglucosaminidase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000027.2-165s1c1
Sequence:CCGGCCCTTTAAGAATGCAACCGAACTCGAGTTCGGTTGCATTCTTAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000027.2-639s1c1
Sequence:CCGGCCTATCCATAAAGAAACAGAACTCGAGTTCTGTTTCTTTATGGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000027.2-152s1c1
Sequence:CCGGCGTCAACACTTGGCCCTTTAACTCGAGTTAAAGGGCCAAGTGTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000027.2-864s1c1
Sequence:CCGGCCAAGCTACCAAGCTGTAGAACTCGAGTTCTACAGCTTGGTAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000027.2-762s1c1
Sequence:CCGGCGTGTAGGAGACTCACCAATACTCGAGTATTGGTGAGTCTCCTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000027.2-762s21c1
Sequence:CCGGCGTGTAGGAGACTCACCAATACTCGAGTATTGGTGAGTCTCCTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000027.2-368s21c1
Sequence:CCGGAGGAGATCTCAGACGAATTAACTCGAGTTAATTCGTCTGAGATCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000027.2-152s21c1
Sequence:CCGGCGTCAACACTTGGCCCTTTAACTCGAGTTAAAGGGCCAAGTGTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000027.2-864s21c1
Sequence:CCGGCCAAGCTACCAAGCTGTAGAACTCGAGTTCTACAGCTTGGTAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000027.2-1552s21c1
Sequence:CCGGCATGTCTTAGCACTGATTATTCTCGAGAATAATCAGTGCTAAGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000027
AGA MISSION shRNA shRNA Plasmid DNA
aspartylglucosaminidase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000027.2-165s1c1
Sequence:CCGGCCCTTTAAGAATGCAACCGAACTCGAGTTCGGTTGCATTCTTAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000027.2-639s1c1
Sequence:CCGGCCTATCCATAAAGAAACAGAACTCGAGTTCTGTTTCTTTATGGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000027.2-152s1c1
Sequence:CCGGCGTCAACACTTGGCCCTTTAACTCGAGTTAAAGGGCCAAGTGTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000027.2-864s1c1
Sequence:CCGGCCAAGCTACCAAGCTGTAGAACTCGAGTTCTACAGCTTGGTAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000027.2-762s1c1
Sequence:CCGGCGTGTAGGAGACTCACCAATACTCGAGTATTGGTGAGTCTCCTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000027.2-762s21c1
Sequence:CCGGCGTGTAGGAGACTCACCAATACTCGAGTATTGGTGAGTCTCCTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000027.2-368s21c1
Sequence:CCGGAGGAGATCTCAGACGAATTAACTCGAGTTAATTCGTCTGAGATCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000027.2-152s21c1
Sequence:CCGGCGTCAACACTTGGCCCTTTAACTCGAGTTAAAGGGCCAAGTGTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000027.2-864s21c1
Sequence:CCGGCCAAGCTACCAAGCTGTAGAACTCGAGTTCTACAGCTTGGTAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000027.2-1552s21c1
Sequence:CCGGCATGTCTTAGCACTGATTATTCTCGAGAATAATCAGTGCTAAGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000027
AGA MISSION shRNA Lentiviral Transduction Particles
aspartylglucosaminidase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000027.2-165s1c1
Sequence:CCGGCCCTTTAAGAATGCAACCGAACTCGAGTTCGGTTGCATTCTTAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000027.2-639s1c1
Sequence:CCGGCCTATCCATAAAGAAACAGAACTCGAGTTCTGTTTCTTTATGGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000027.2-152s1c1
Sequence:CCGGCGTCAACACTTGGCCCTTTAACTCGAGTTAAAGGGCCAAGTGTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000027.2-864s1c1
Sequence:CCGGCCAAGCTACCAAGCTGTAGAACTCGAGTTCTACAGCTTGGTAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000027.2-762s1c1
Sequence:CCGGCGTGTAGGAGACTCACCAATACTCGAGTATTGGTGAGTCTCCTACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000027.2-762s21c1
Sequence:CCGGCGTGTAGGAGACTCACCAATACTCGAGTATTGGTGAGTCTCCTACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000027.2-368s21c1
Sequence:CCGGAGGAGATCTCAGACGAATTAACTCGAGTTAATTCGTCTGAGATCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000027.2-152s21c1
Sequence:CCGGCGTCAACACTTGGCCCTTTAACTCGAGTTAAAGGGCCAAGTGTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000027.2-864s21c1
Sequence:CCGGCCAAGCTACCAAGCTGTAGAACTCGAGTTCTACAGCTTGGTAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000027.2-1552s21c1
Sequence:CCGGCATGTCTTAGCACTGATTATTCTCGAGAATAATCAGTGCTAAGACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_134151
VALIDATED
AGA MISSION shRNA Bacterial Glycerol Stock
aspartylglucosaminidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134151.3-1022s1c1
Sequence:CCGGGCCAGTGTGAACGGAAGTTATCTCGAGATAACTTCCGTTCACACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134151.3-591s1c1
Sequence:CCGGGCCAGCCAAATTATTGGAGAACTCGAGTTCTCCAATAATTTGGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134151.3-909s1c1
Sequence:CCGGGCTACCAAGCTGTAGAATATACTCGAGTATATTCTACAGCTTGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134151.3-368s1c1
Sequence:CCGGGCCATGATAATGGATGGCACTCTCGAGAGTGCCATCCATTATCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134151.3-1053s1c1
Sequence:CCGGGCAACAAACTTCCAACATTTACTCGAGTAAATGTTGGAAGTTTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_134151
VALIDATED
AGA MISSION shRNA shRNA Plasmid DNA
aspartylglucosaminidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134151.3-1022s1c1
Sequence:CCGGGCCAGTGTGAACGGAAGTTATCTCGAGATAACTTCCGTTCACACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134151.3-591s1c1
Sequence:CCGGGCCAGCCAAATTATTGGAGAACTCGAGTTCTCCAATAATTTGGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134151.3-909s1c1
Sequence:CCGGGCTACCAAGCTGTAGAATATACTCGAGTATATTCTACAGCTTGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134151.3-368s1c1
Sequence:CCGGGCCATGATAATGGATGGCACTCTCGAGAGTGCCATCCATTATCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134151.3-1053s1c1
Sequence:CCGGGCAACAAACTTCCAACATTTACTCGAGTAAATGTTGGAAGTTTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_134151
VALIDATED
AGA MISSION shRNA Lentiviral Transduction Particles
aspartylglucosaminidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134151.3-1022s1c1
Sequence:CCGGGCCAGTGTGAACGGAAGTTATCTCGAGATAACTTCCGTTCACACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134151.3-591s1c1
Sequence:CCGGGCCAGCCAAATTATTGGAGAACTCGAGTTCTCCAATAATTTGGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134151.3-909s1c1
Sequence:CCGGGCTACCAAGCTGTAGAATATACTCGAGTATATTCTACAGCTTGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134151.3-368s1c1
Sequence:CCGGGCCATGATAATGGATGGCACTCTCGAGAGTGCCATCCATTATCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_134151.3-1053s1c1
Sequence:CCGGGCAACAAACTTCCAACATTTACTCGAGTAAATGTTGGAAGTTTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)