EMAIL THIS PAGE TO A FRIEND

AGAP6

ArfGAP with GTPase domain, ankyrin repeat and PH domain 6

26 Gene Product Result for
Synonyms: AGAP-6 CTGLF3 bA324H6.1
Species: Human AGAP6(414189)
UniProtKB ID: Q5VW22
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001077665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077665 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077665
AGAP6 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with GTPase domain, ankyrin repeat and PH domain 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077665.2-1327s21c1
Sequence:CCGGATGGCATGCTCACCTATTATTCTCGAGAATAATAGGTGAGCATGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077665.2-822s21c1
Sequence:CCGGTACAGCTTGTGTTCGACAATACTCGAGTATTGTCGAACACAAGCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077665.2-2543s21c1
Sequence:CCGGCACAAATTCAGCTAATATTAGCTCGAGCTAATATTAGCTGAATTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077665.2-1141s21c1
Sequence:CCGGTGCGCTGGTCCAACCTGTTTACTCGAGTAAACAGGTTGGACCAGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077665.2-2091s21c1
Sequence:CCGGCGGTGGATCCGTTCCAAATATCTCGAGATATTTGGAACGGATCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077665
AGAP6 MISSION shRNA shRNA Plasmid DNA
ArfGAP with GTPase domain, ankyrin repeat and PH domain 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077665.2-1327s21c1
Sequence:CCGGATGGCATGCTCACCTATTATTCTCGAGAATAATAGGTGAGCATGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077665.2-822s21c1
Sequence:CCGGTACAGCTTGTGTTCGACAATACTCGAGTATTGTCGAACACAAGCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077665.2-2543s21c1
Sequence:CCGGCACAAATTCAGCTAATATTAGCTCGAGCTAATATTAGCTGAATTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077665.2-1141s21c1
Sequence:CCGGTGCGCTGGTCCAACCTGTTTACTCGAGTAAACAGGTTGGACCAGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077665.2-2091s21c1
Sequence:CCGGCGGTGGATCCGTTCCAAATATCTCGAGATATTTGGAACGGATCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077665
AGAP6 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with GTPase domain, ankyrin repeat and PH domain 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077665.2-1327s21c1
Sequence:CCGGATGGCATGCTCACCTATTATTCTCGAGAATAATAGGTGAGCATGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077665.2-822s21c1
Sequence:CCGGTACAGCTTGTGTTCGACAATACTCGAGTATTGTCGAACACAAGCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077665.2-2543s21c1
Sequence:CCGGCACAAATTCAGCTAATATTAGCTCGAGCTAATATTAGCTGAATTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077665.2-1141s21c1
Sequence:CCGGTGCGCTGGTCCAACCTGTTTACTCGAGTAAACAGGTTGGACCAGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077665.2-2091s21c1
Sequence:CCGGCGGTGGATCCGTTCCAAATATCTCGAGATATTTGGAACGGATCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)