EMAIL THIS PAGE TO A FRIEND

AGBL1

ATP/GTP binding protein-like 1

78 Gene Product Result for
UniProtKB ID: Q96MI9, A1A4X5, A6NJH6, C9JHL5
Gene ID:
Mouse(244071) ATP/GTP binding protein-like 1
Rat(308724) ATP/GTP binding protein-like 1
chicken(427507) ATP/GTP binding protein-like 1
dog(479034) ATP/GTP binding protein-like 1
Horse(100070057) ATP/GTP binding protein-like 1
domestic cat(101092766) ATP/GTP binding protein-like 1
naked mole-rat(101725425) ATP/GTP binding protein-like 1
domestic guinea pig(100733157) ATP/GTP binding protein-like 1
sheep(101115736) ATP/GTP binding protein-like 1
Domestic Rabbit(100352303) ATP/GTP binding protein-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301031 Anti-AGBL1 antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152336 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172902 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172902 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172902 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036351 MISSION® esiRNA esiRNA human AGBL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152336 Rosetta Predictions human pricing
XM_001063833 Rosetta Predictions rat pricing
XM_218798 Rosetta Predictions rat pricing
NM_172902 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365944 predicted 669
2 SASI_Hs01_00072791 predicted 1874
3 SASI_Hs01_00072792 predicted 1704
4 SASI_Hs02_00365945 predicted 883
5 SASI_Hs02_00365946 predicted 2289
6 SASI_Hs02_00365947 predicted 2920
7 SASI_Hs02_00365948 predicted 2299
8 SASI_Hs01_00072795 predicted 1477
9 SASI_Hs01_00072796 predicted 1898
10 SASI_Hs02_00365949 predicted 995
11 SASI_Hs01_00072790 predicted 837
12 SASI_Hs01_00072793 predicted 880
13 SASI_Hs01_00072794 predicted 1204
14 SASI_Hs01_00072797 predicted 1198
15 SASI_Hs01_00072798 predicted 1078
16 SASI_Hs01_00072799 predicted 1473
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063833 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308437 predicted 1552
2 SASI_Rn02_00308438 predicted 1377
3 SASI_Rn02_00308439 predicted 804
4 SASI_Rn02_00308440 predicted 2335
5 SASI_Rn02_00308441 predicted 709
6 SASI_Rn02_00308442 predicted 788
7 SASI_Rn02_00308443 predicted 1879
8 SASI_Rn02_00308444 predicted 1107
9 SASI_Rn02_00308445 predicted 1284
10 SASI_Rn02_00308446 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378072 predicted 1362
2 SASI_Rn02_00378073 predicted 1083
3 SASI_Rn02_00378074 predicted 906
4 SASI_Rn02_00378075 predicted 328
5 SASI_Rn02_00378076 predicted 546
6 SASI_Rn02_00378077 predicted 239
7 SASI_Rn02_00378078 predicted 326
8 SASI_Rn02_00378079 predicted 1094
9 SASI_Rn02_00378080 predicted 640
10 SASI_Rn02_00378081 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066277 predicted 1607
2 SASI_Mm01_00066278 predicted 1322
3 SASI_Mm01_00066279 predicted 890
4 SASI_Mm01_00066280 predicted 2224
5 SASI_Mm01_00066281 predicted 2164
6 SASI_Mm01_00066282 predicted 2109
7 SASI_Mm01_00066283 predicted 1424
8 SASI_Mm01_00066284 predicted 2138
9 SASI_Mm01_00066285 predicted 582
10 SASI_Mm01_00066286 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152336
AGBL1 MISSION shRNA Bacterial Glycerol Stock
ATP/GTP binding protein-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152336.2-2310s21c1
Sequence:CCGGCAGTTCCGACATCGTCCATATCTCGAGATATGGACGATGTCGGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152336.2-1723s21c1
Sequence:CCGGTACGGTTCTTCTCCAAATTTGCTCGAGCAAATTTGGAGAAGAACCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152336.2-2056s21c1
Sequence:CCGGCATCTGGGAAGTGCTACTATACTCGAGTATAGTAGCACTTCCCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-1913s1c1
Sequence:CCGGGCTCTAGCTAAGAACTTTGAACTCGAGTTCAAAGTTCTTAGCTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-104s1c1
Sequence:CCGGGAAGAGGAACTGATGCAATATCTCGAGATATTGCATCAGTTCCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-548s1c1
Sequence:CCGGGCCAAAGTAATAGATAAGCTTCTCGAGAAGCTTATCTATTACTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-902s1c1
Sequence:CCGGCAAGTGCGTGAGTTCGAGTATCTCGAGATACTCGAACTCACGCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-1971s1c1
Sequence:CCGGCACACACAAATATACGCATATCTCGAGATATGCGTATATTTGTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-907s1c1
Sequence:CCGGGCGTGAGTTCGAGTATGACTTCTCGAGAAGTCATACTCGAACTCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-1069s1c1
Sequence:CCGGGCCCACCCTATATTCTGTGAACTCGAGTTCACAGAATATAGGGTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152336
AGBL1 MISSION shRNA shRNA Plasmid DNA
ATP/GTP binding protein-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152336.2-2310s21c1
Sequence:CCGGCAGTTCCGACATCGTCCATATCTCGAGATATGGACGATGTCGGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152336.2-1723s21c1
Sequence:CCGGTACGGTTCTTCTCCAAATTTGCTCGAGCAAATTTGGAGAAGAACCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152336.2-2056s21c1
Sequence:CCGGCATCTGGGAAGTGCTACTATACTCGAGTATAGTAGCACTTCCCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-1913s1c1
Sequence:CCGGGCTCTAGCTAAGAACTTTGAACTCGAGTTCAAAGTTCTTAGCTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-104s1c1
Sequence:CCGGGAAGAGGAACTGATGCAATATCTCGAGATATTGCATCAGTTCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-548s1c1
Sequence:CCGGGCCAAAGTAATAGATAAGCTTCTCGAGAAGCTTATCTATTACTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-902s1c1
Sequence:CCGGCAAGTGCGTGAGTTCGAGTATCTCGAGATACTCGAACTCACGCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-1971s1c1
Sequence:CCGGCACACACAAATATACGCATATCTCGAGATATGCGTATATTTGTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-907s1c1
Sequence:CCGGGCGTGAGTTCGAGTATGACTTCTCGAGAAGTCATACTCGAACTCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-1069s1c1
Sequence:CCGGGCCCACCCTATATTCTGTGAACTCGAGTTCACAGAATATAGGGTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152336
AGBL1 MISSION shRNA Lentiviral Transduction Particles
ATP/GTP binding protein-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152336.2-2310s21c1
Sequence:CCGGCAGTTCCGACATCGTCCATATCTCGAGATATGGACGATGTCGGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152336.2-1723s21c1
Sequence:CCGGTACGGTTCTTCTCCAAATTTGCTCGAGCAAATTTGGAGAAGAACCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152336.2-2056s21c1
Sequence:CCGGCATCTGGGAAGTGCTACTATACTCGAGTATAGTAGCACTTCCCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-1913s1c1
Sequence:CCGGGCTCTAGCTAAGAACTTTGAACTCGAGTTCAAAGTTCTTAGCTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-104s1c1
Sequence:CCGGGAAGAGGAACTGATGCAATATCTCGAGATATTGCATCAGTTCCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-548s1c1
Sequence:CCGGGCCAAAGTAATAGATAAGCTTCTCGAGAAGCTTATCTATTACTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-902s1c1
Sequence:CCGGCAAGTGCGTGAGTTCGAGTATCTCGAGATACTCGAACTCACGCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-1971s1c1
Sequence:CCGGCACACACAAATATACGCATATCTCGAGATATGCGTATATTTGTGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-907s1c1
Sequence:CCGGGCGTGAGTTCGAGTATGACTTCTCGAGAAGTCATACTCGAACTCACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152336.1-1069s1c1
Sequence:CCGGGCCCACCCTATATTCTGTGAACTCGAGTTCACAGAATATAGGGTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172902
AGBL1 MISSION shRNA Bacterial Glycerol Stock
ATP/GTP binding protein-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172902.1-2106s1c1
Sequence:CCGGCCAACCATCTACCATGCTAAACTCGAGTTTAGCATGGTAGATGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172902.1-1479s1c1
Sequence:CCGGCCAACCCTGTATTCTGTGAAACTCGAGTTTCACAGAATACAGGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172902.1-1181s1c1
Sequence:CCGGCCTCCATCCAAGTGATGTTATCTCGAGATAACATCACTTGGATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172902.1-909s1c1
Sequence:CCGGCCAAGGATAACTGCTTCATTTCTCGAGAAATGAAGCAGTTATCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172902.1-1608s1c1
Sequence:CCGGCGCTACTACACCCTTACCTTTCTCGAGAAAGGTAAGGGTGTAGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172902
AGBL1 MISSION shRNA shRNA Plasmid DNA
ATP/GTP binding protein-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172902.1-2106s1c1
Sequence:CCGGCCAACCATCTACCATGCTAAACTCGAGTTTAGCATGGTAGATGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172902.1-1479s1c1
Sequence:CCGGCCAACCCTGTATTCTGTGAAACTCGAGTTTCACAGAATACAGGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172902.1-1181s1c1
Sequence:CCGGCCTCCATCCAAGTGATGTTATCTCGAGATAACATCACTTGGATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172902.1-909s1c1
Sequence:CCGGCCAAGGATAACTGCTTCATTTCTCGAGAAATGAAGCAGTTATCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172902.1-1608s1c1
Sequence:CCGGCGCTACTACACCCTTACCTTTCTCGAGAAAGGTAAGGGTGTAGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172902
AGBL1 MISSION shRNA Lentiviral Transduction Particles
ATP/GTP binding protein-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172902.1-2106s1c1
Sequence:CCGGCCAACCATCTACCATGCTAAACTCGAGTTTAGCATGGTAGATGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172902.1-1479s1c1
Sequence:CCGGCCAACCCTGTATTCTGTGAAACTCGAGTTTCACAGAATACAGGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172902.1-1181s1c1
Sequence:CCGGCCTCCATCCAAGTGATGTTATCTCGAGATAACATCACTTGGATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172902.1-909s1c1
Sequence:CCGGCCAAGGATAACTGCTTCATTTCTCGAGAAATGAAGCAGTTATCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172902.1-1608s1c1
Sequence:CCGGCGCTACTACACCCTTACCTTTCTCGAGAAAGGTAAGGGTGTAGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)