EMAIL THIS PAGE TO A FRIEND

AGT

angiotensinogen (serpin peptidase inhibitor, clade A, member 8)

72 Gene Product Result for
Synonyms: ANHU SERPINA8
UniProtKB ID: P01019, Q16358, Q16359, Q96F91
Gene ID:
Human(183) Summary: The protein encoded by this gene, pre-angiotensinogen or angiotensinogen precursor, is expressed in the liver and is cleaved by the enzyme renin in response to lowered blood pressure. The resulting product, angiotensin I, is then cleaved by angiotensin converting enzyme (ACE) to generate the physiologically active enzyme angiotensin II. The protein is involved in maintaining blood pressure and in the pathogenesis of essential hypertension and preeclampsia. Mutations in this gene are associated with susceptibility to essential hypertension, and can cause renal tubular dysgenesis, a severe disorder of renal tubular development. Defects in this gene have also been associated with non-familial structural atrial fibrillation, and inflammatory bowel disease. [provided by RefSeq, Jul 2008]
Mouse(11606) angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
Rat(24179) angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
Zebrafish(322485) angiotensinogen
Thale Cress(815822) alanine--glyoxylate aminotransferase
fruit fly(40816) O-6-alkylguanine-DNA alkyltransferase
cow(527114) angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
domestic cat(101093714) angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
dog(403783) angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
chicken(421543) angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
naked mole-rat(101717217) angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
domestic guinea pig(100724950) angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
sheep(101119440) angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
sheep(100294599) angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0452 AQUA Peptide ALQDQLVLVAA[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000029 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007428 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007428 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007428 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131721 MISSION® esiRNA esiRNA human AGT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000029 Rosetta Predictions human pricing
NM_134432 Rosetta Predictions rat pricing
NM_007428 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175036 predicted 668
2 SASI_Hs01_00175037 predicted 1467
3 SASI_Hs01_00175039 predicted 1250
4 SASI_Hs02_00301698 predicted 2045
5 SASI_Hs01_00175040 predicted 835
6 SASI_Hs02_00301699 predicted 2097
7 SASI_Hs01_00175043 predicted 1424
8 SASI_Hs01_00175044 predicted 937
9 SASI_Hs01_00175045 predicted 1337
10 SASI_Hs02_00301700 predicted 1316
11 SASI_Hs01_00175038 predicted 1079
12 SASI_Hs01_00175041 predicted 598
13 SASI_Hs01_00175042 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134432 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268027 predicted 215
2 SASI_Rn01_00083036 predicted 362
3 SASI_Rn01_00083038 predicted 722
4 SASI_Rn01_00083039 predicted 1146
5 SASI_Rn01_00083040 predicted 1574
6 SASI_Rn01_00083041 predicted 1255
7 SASI_Rn01_00083042 predicted 365
8 SASI_Rn01_00083044 predicted 1397
9 SASI_Rn01_00083045 predicted 1579
10 SASI_Rn02_00268028 predicted 1430
11 SASI_Rn01_00083037 predicted 893
12 SASI_Rn01_00083043 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311581 predicted 1123
2 SASI_Mm02_00311582 predicted 998
3 SASI_Mm01_00020870 predicted 1249
4 SASI_Mm01_00020871 predicted 1474
5 SASI_Mm01_00020873 predicted 223
6 SASI_Mm02_00311583 predicted 1532
7 SASI_Mm01_00020875 predicted 1187
8 SASI_Mm01_00020876 predicted 1439
9 SASI_Mm02_00311584 predicted 1098
10 SASI_Mm01_00020878 predicted 881
11 SASI_Mm01_00020872 predicted 563
12 SASI_Mm01_00020874 predicted 1509
13 SASI_Mm01_00020877 predicted 207
14 SASI_Mm01_00020879 predicted 437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000029
AGT MISSION shRNA Bacterial Glycerol Stock
angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000029.3-1659s21c1
Sequence:CCGGTGGTGCTGCAAGGATCTTATGCTCGAGCATAAGATCCTTGCAGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000029.3-841s21c1
Sequence:CCGGCTTCTTGGGCTTCCGTATATACTCGAGTATATACGGAAGCCCAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000029.3-2089s21c1
Sequence:CCGGTCTTCTAATGAGTCGACTTTGCTCGAGCAAAGTCGACTCATTAGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000029.1-1947s1c1
Sequence:CCGGCCTCCGTGTAGTGTCTGTAATCTCGAGATTACAGACACTACACGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000029.1-528s1c1
Sequence:CCGGTGTTCCTTGGAAGGACAAGAACTCGAGTTCTTGTCCTTCCAAGGAACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000029.1-930s1c1
Sequence:CCGGCCAGGAGTTCTGGGTGGACAACTCGAGTTGTCCACCCAGAACTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000029.1-233s1c1
Sequence:CCGGCCACCTTCATACCTGCTCCAACTCGAGTTGGAGCAGGTATGAAGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000029.1-1374s1c1
Sequence:CCGGGCTTAACAAGCCTGAGGTCTTCTCGAGAAGACCTCAGGCTTGTTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000029
AGT MISSION shRNA shRNA Plasmid DNA
angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000029.3-1659s21c1
Sequence:CCGGTGGTGCTGCAAGGATCTTATGCTCGAGCATAAGATCCTTGCAGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000029.3-841s21c1
Sequence:CCGGCTTCTTGGGCTTCCGTATATACTCGAGTATATACGGAAGCCCAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000029.3-2089s21c1
Sequence:CCGGTCTTCTAATGAGTCGACTTTGCTCGAGCAAAGTCGACTCATTAGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000029.1-1947s1c1
Sequence:CCGGCCTCCGTGTAGTGTCTGTAATCTCGAGATTACAGACACTACACGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000029.1-528s1c1
Sequence:CCGGTGTTCCTTGGAAGGACAAGAACTCGAGTTCTTGTCCTTCCAAGGAACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000029.1-930s1c1
Sequence:CCGGCCAGGAGTTCTGGGTGGACAACTCGAGTTGTCCACCCAGAACTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000029.1-233s1c1
Sequence:CCGGCCACCTTCATACCTGCTCCAACTCGAGTTGGAGCAGGTATGAAGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000029.1-1374s1c1
Sequence:CCGGGCTTAACAAGCCTGAGGTCTTCTCGAGAAGACCTCAGGCTTGTTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000029
AGT MISSION shRNA Lentiviral Transduction Particles
angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000029.3-1659s21c1
Sequence:CCGGTGGTGCTGCAAGGATCTTATGCTCGAGCATAAGATCCTTGCAGCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000029.3-841s21c1
Sequence:CCGGCTTCTTGGGCTTCCGTATATACTCGAGTATATACGGAAGCCCAAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000029.3-2089s21c1
Sequence:CCGGTCTTCTAATGAGTCGACTTTGCTCGAGCAAAGTCGACTCATTAGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000029.1-1947s1c1
Sequence:CCGGCCTCCGTGTAGTGTCTGTAATCTCGAGATTACAGACACTACACGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000029.1-528s1c1
Sequence:CCGGTGTTCCTTGGAAGGACAAGAACTCGAGTTCTTGTCCTTCCAAGGAACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000029.1-930s1c1
Sequence:CCGGCCAGGAGTTCTGGGTGGACAACTCGAGTTGTCCACCCAGAACTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000029.1-233s1c1
Sequence:CCGGCCACCTTCATACCTGCTCCAACTCGAGTTGGAGCAGGTATGAAGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000029.1-1374s1c1
Sequence:CCGGGCTTAACAAGCCTGAGGTCTTCTCGAGAAGACCTCAGGCTTGTTAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007428
AGT MISSION shRNA Bacterial Glycerol Stock
angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007428.2-356s1c1
Sequence:CCGGCCGCATGTACAAGATGCTGAACTCGAGTTCAGCATCTTGTACATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007428.2-1233s1c1
Sequence:CCGGGAGGCAAATCTGAACAACATTCTCGAGAATGTTGTTCAGATTTGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007428.2-655s1c1
Sequence:CCGGGCTTTCGTCTAAAGCACTCATCTCGAGATGAGTGCTTTAGACGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007428.2-863s1c1
Sequence:CCGGCCAAGGAACGATGAGAGGTTTCTCGAGAAACCTCTCATCGTTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007428.2-1508s1c1
Sequence:CCGGCGGAGAACCATTCTGGGCAAACTCGAGTTTGCCCAGAATGGTTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007428
AGT MISSION shRNA shRNA Plasmid DNA
angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007428.2-356s1c1
Sequence:CCGGCCGCATGTACAAGATGCTGAACTCGAGTTCAGCATCTTGTACATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007428.2-1233s1c1
Sequence:CCGGGAGGCAAATCTGAACAACATTCTCGAGAATGTTGTTCAGATTTGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007428.2-655s1c1
Sequence:CCGGGCTTTCGTCTAAAGCACTCATCTCGAGATGAGTGCTTTAGACGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007428.2-863s1c1
Sequence:CCGGCCAAGGAACGATGAGAGGTTTCTCGAGAAACCTCTCATCGTTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007428.2-1508s1c1
Sequence:CCGGCGGAGAACCATTCTGGGCAAACTCGAGTTTGCCCAGAATGGTTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007428
AGT MISSION shRNA Lentiviral Transduction Particles
angiotensinogen (serpin peptidase inhibitor, clade A, member 8)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007428.2-356s1c1
Sequence:CCGGCCGCATGTACAAGATGCTGAACTCGAGTTCAGCATCTTGTACATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007428.2-1233s1c1
Sequence:CCGGGAGGCAAATCTGAACAACATTCTCGAGAATGTTGTTCAGATTTGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007428.2-655s1c1
Sequence:CCGGGCTTTCGTCTAAAGCACTCATCTCGAGATGAGTGCTTTAGACGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007428.2-863s1c1
Sequence:CCGGCCAAGGAACGATGAGAGGTTTCTCGAGAAACCTCTCATCGTTCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007428.2-1508s1c1
Sequence:CCGGCGGAGAACCATTCTGGGCAAACTCGAGTTTGCCCAGAATGGTTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)