EMAIL THIS PAGE TO A FRIEND

AHR

aryl hydrocarbon receptor

215 Gene Product Result for
Synonyms: bHLHe76
UniProtKB ID: P35869, A4D130, Q13728, Q13803, Q13804
Gene ID:
Human(196) Summary: This gene encodes a ligand-activated transcription factor involved in the regulation of biological responses to planar aromatic hydrocarbons. This receptor has been shown to regulate xenobiotic-metabolizing enzymes such as cytochrome P450. Its ligands included a variety of aromatic hydrocarbons. [provided by RefSeq, Jul 2008]
Mouse(11622) aryl-hydrocarbon receptor
Rat(25690) aryl hydrocarbon receptor
chicken(373907) aryl hydrocarbon receptor
cow(280714) aryl hydrocarbon receptor
Horse(100066186) aryl hydrocarbon receptor
domestic cat(101084947) aryl hydrocarbon receptor
dog(475251) aryl hydrocarbon receptor
naked mole-rat(101708722) aryl hydrocarbon receptor
domestic guinea pig(100192396) aryl-hydrocarbon receptor
sheep(443467) aryl hydrocarbon receptor
Domestic Rabbit(100008995) aryl hydrocarbon receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108470 Anti-AHR IgG fraction of antiserum human, canine, sheep, bovine, mouse, rat, guinea pig, rabbit
immunohistochemistry, western blot pricing
A9359 Anti-AHR (776-790) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV31635 Anti-AHR (AB1) antibody produced in rabbit IgG fraction of antiserum guinea pig, human, bovine, canine, mouse, rat, rabbit
western blot pricing
AV32243 Anti-AHR (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, rat, human, bovine, rabbit, pig, canine, guinea pig, sheep
immunohistochemistry, western blot pricing
SAB1405440 Anti-AHR antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1412003 ANTI-AHR antibody produced in mouse clone 3H4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412324 ANTI-AHR antibody produced in mouse clone 1D4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412325 ANTI-AHR antibody produced in mouse clone 3B1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412326 ANTI-AHR antibody produced in mouse clone 3B9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412327 ANTI-AHR antibody produced in mouse clone 3B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA029722 Anti-AHR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunofluorescence, immunohistochemistry pricing
HPA029723 Anti-AHR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunohistochemistry, western blot pricing
SAB4500725 Anti-AHR, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504075 Anti-phospho-AhR (pSer36) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301568 Anti-phospho-AhR (pSer36) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
WH0000196M2 Monoclonal Anti-AHR antibody produced in mouse clone 3B12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1403535 Monoclonal Anti-AHR antibody produced in mouse clone 4G7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001621 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001621 Rosetta Predictions human pricing
NM_013149 Rosetta Predictions rat pricing
XM_579375 Rosetta Predictions rat pricing
NM_013464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332181 predicted 966
2 SASI_Hs01_00140198 predicted 1674
3 SASI_Hs02_00332182 predicted 2658
4 SASI_Hs01_00140199 predicted 1436
5 SASI_Hs01_00140201 predicted 1990
6 SASI_Hs01_00140202 predicted 784
7 SASI_Hs01_00140203 predicted 1029
8 SASI_Hs01_00140204 predicted 2290
9 SASI_Hs01_00140205 predicted 2764
10 SASI_Hs01_00140206 predicted 1959
11 SASI_Hs01_00140197 predicted 2513
12 SASI_Hs01_00140200 predicted 2331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112270 predicted 464
2 SASI_Rn01_00112271 predicted 993
3 SASI_Rn01_00112275 predicted 713
4 SASI_Rn01_00112276 predicted 1145
5 SASI_Rn02_00260951 predicted 1018
6 SASI_Rn01_00112277 predicted 436
7 SASI_Rn01_00112278 predicted 624
8 SASI_Rn01_00112279 predicted 1737
9 SASI_Rn02_00260952 predicted 932
10 SASI_Rn02_00260953 predicted 667
11 SASI_Rn01_00112272 predicted 1219
12 SASI_Rn01_00112273 predicted 2414
13 SASI_Rn01_00112274 predicted 1992
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00188140 predicted 961
2 SASI_Rn01_00188141 predicted 495
3 SASI_Rn01_00188142 predicted 1025
4 SASI_Rn01_00188143 predicted 754
5 SASI_Rn01_00188144 predicted 809
6 SASI_Rn01_00188145 predicted 472
7 SASI_Rn01_00188146 predicted 660
8 SASI_Rn01_00188147 predicted 1771
9 SASI_Rn01_00188148 predicted 967
10 SASI_Rn01_00188149 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168274 predicted 1022
2 SASI_Mm01_00168275 predicted 2560
3 SASI_Mm01_00168277 predicted 449
4 SASI_Mm01_00168278 predicted 2458
5 SASI_Mm01_00168279 predicted 1522
6 SASI_Mm01_00168280 predicted 1067
7 SASI_Mm01_00168281 predicted 1371
8 SASI_Mm01_00168282 predicted 2734
9 SASI_Mm01_00168283 predicted 1341
10 SASI_Mm02_00322080 predicted 824
11 SASI_Mm01_00168276 predicted 1170
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001621
VALIDATED
AHR MISSION shRNA Bacterial Glycerol Stock
aryl hydrocarbon receptor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001621.3-1586s21c1
Sequence:CCGGAGTCCCATATCCGAATGATTACTCGAGTAATCATTCGGATATGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001621.3-2840s21c1
Sequence:CCGGATCCACAGTCAGCCATAATAACTCGAGTTATTATGGCTGACTGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001621.3-693s21c1
Sequence:CCGGGCGGCATAGAGACCGACTTAACTCGAGTTAAGTCGGTCTCTATGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001621.3-4524s21c1
Sequence:CCGGACTGCTTAAAGTTGGTATTAACTCGAGTTAATACCAACTTTAAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_001621.3-1965s21c1
Sequence:CCGGGCAACAAGATGAGTCTATTTACTCGAGTAAATAGACTCATCTTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001621.2-2913s1c1
Sequence:CCGGCCATAATAACTCCTCAGACATCTCGAGATGTCTGAGGAGTTATTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001621.2-885s1c1
Sequence:CCGGGCTTCTTTGATGTTGCATTAACTCGAGTTAATGCAACATCAAAGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001621.2-1658s1c1
Sequence:CCGGCGAATGATTAAGACTGGAGAACTCGAGTTCTCCAGTCTTAATCATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001621.2-2647s1c1
Sequence:CCGGCCCACAACAATATAATGTCTTCTCGAGAAGACATTATATTGTTGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001621.2-755s1c1
Sequence:CCGGCGGCATAGAGACCGACTTAATCTCGAGATTAAGTCGGTCTCTATGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001621
VALIDATED
AHR MISSION shRNA shRNA Plasmid DNA
aryl hydrocarbon receptor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001621.3-1586s21c1
Sequence:CCGGAGTCCCATATCCGAATGATTACTCGAGTAATCATTCGGATATGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001621.3-2840s21c1
Sequence:CCGGATCCACAGTCAGCCATAATAACTCGAGTTATTATGGCTGACTGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001621.3-693s21c1
Sequence:CCGGGCGGCATAGAGACCGACTTAACTCGAGTTAAGTCGGTCTCTATGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001621.3-4524s21c1
Sequence:CCGGACTGCTTAAAGTTGGTATTAACTCGAGTTAATACCAACTTTAAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_001621.3-1965s21c1
Sequence:CCGGGCAACAAGATGAGTCTATTTACTCGAGTAAATAGACTCATCTTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001621.2-2913s1c1
Sequence:CCGGCCATAATAACTCCTCAGACATCTCGAGATGTCTGAGGAGTTATTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001621.2-885s1c1
Sequence:CCGGGCTTCTTTGATGTTGCATTAACTCGAGTTAATGCAACATCAAAGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001621.2-1658s1c1
Sequence:CCGGCGAATGATTAAGACTGGAGAACTCGAGTTCTCCAGTCTTAATCATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001621.2-2647s1c1
Sequence:CCGGCCCACAACAATATAATGTCTTCTCGAGAAGACATTATATTGTTGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001621.2-755s1c1
Sequence:CCGGCGGCATAGAGACCGACTTAATCTCGAGATTAAGTCGGTCTCTATGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001621
VALIDATED
AHR MISSION shRNA Lentiviral Transduction Particles
aryl hydrocarbon receptor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001621.3-1586s21c1
Sequence:CCGGAGTCCCATATCCGAATGATTACTCGAGTAATCATTCGGATATGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001621.3-2840s21c1
Sequence:CCGGATCCACAGTCAGCCATAATAACTCGAGTTATTATGGCTGACTGTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001621.3-693s21c1
Sequence:CCGGGCGGCATAGAGACCGACTTAACTCGAGTTAAGTCGGTCTCTATGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001621.3-4524s21c1
Sequence:CCGGACTGCTTAAAGTTGGTATTAACTCGAGTTAATACCAACTTTAAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_001621.3-1965s21c1
Sequence:CCGGGCAACAAGATGAGTCTATTTACTCGAGTAAATAGACTCATCTTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001621.2-2913s1c1
Sequence:CCGGCCATAATAACTCCTCAGACATCTCGAGATGTCTGAGGAGTTATTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001621.2-885s1c1
Sequence:CCGGGCTTCTTTGATGTTGCATTAACTCGAGTTAATGCAACATCAAAGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001621.2-1658s1c1
Sequence:CCGGCGAATGATTAAGACTGGAGAACTCGAGTTCTCCAGTCTTAATCATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001621.2-2647s1c1
Sequence:CCGGCCCACAACAATATAATGTCTTCTCGAGAAGACATTATATTGTTGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001621.2-755s1c1
Sequence:CCGGCGGCATAGAGACCGACTTAATCTCGAGATTAAGTCGGTCTCTATGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013464
VALIDATED
AHR MISSION shRNA Bacterial Glycerol Stock
aryl hydrocarbon receptor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013464.4-938s21c1
Sequence:CCGGCACAGGCAGCAGTCTATTATACTCGAGTATAATAGACTGCTGCCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013464.4-2070s21c1
Sequence:CCGGCATCGACATAACGGACGAAATCTCGAGATTTCGTCCGTTATGTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013464.4-3856s21c1
Sequence:GTACCGGGTCAAGCCTGTTAGCTATATTCTCGAGAATATAGCTAACAGGCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013464.4-1926s21c1
Sequence:CCGGAGAGCTCTTTCCGGATAATAACTCGAGTTATTATCCGGAAAGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013464.4-817s21c1
Sequence:CCGGGTCATCCATCAGAGCGTATATCTCGAGATATACGCTCTGATGGATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013464.2-941s1c1
Sequence:CCGGGCTGGATAATTCATCTGGTTTCTCGAGAAACCAGATGAATTATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013464.2-2328s1c1
Sequence:CCGGGCTCAGGAATTTCCCTACAAACTCGAGTTTGTAGGGAAATTCCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013464.2-439s1c1
Sequence:CCGGCCTTCCCGCAAGATGTTATTACTCGAGTAATAACATCTTGCGGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013464.2-1773s1c1
Sequence:CCGGGCGCTGAAACATGAGCAAATTCTCGAGAATTTGCTCATGTTTCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013464.2-1359s1c1
Sequence:CCGGGCACGCTTGATTTACAGAAATCTCGAGATTTCTGTAAATCAAGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013464
VALIDATED
AHR MISSION shRNA shRNA Plasmid DNA
aryl hydrocarbon receptor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013464.4-938s21c1
Sequence:CCGGCACAGGCAGCAGTCTATTATACTCGAGTATAATAGACTGCTGCCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013464.4-2070s21c1
Sequence:CCGGCATCGACATAACGGACGAAATCTCGAGATTTCGTCCGTTATGTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013464.4-3856s21c1
Sequence:GTACCGGGTCAAGCCTGTTAGCTATATTCTCGAGAATATAGCTAACAGGCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013464.4-1926s21c1
Sequence:CCGGAGAGCTCTTTCCGGATAATAACTCGAGTTATTATCCGGAAAGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013464.4-817s21c1
Sequence:CCGGGTCATCCATCAGAGCGTATATCTCGAGATATACGCTCTGATGGATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013464.2-941s1c1
Sequence:CCGGGCTGGATAATTCATCTGGTTTCTCGAGAAACCAGATGAATTATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013464.2-2328s1c1
Sequence:CCGGGCTCAGGAATTTCCCTACAAACTCGAGTTTGTAGGGAAATTCCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013464.2-439s1c1
Sequence:CCGGCCTTCCCGCAAGATGTTATTACTCGAGTAATAACATCTTGCGGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013464.2-1773s1c1
Sequence:CCGGGCGCTGAAACATGAGCAAATTCTCGAGAATTTGCTCATGTTTCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013464.2-1359s1c1
Sequence:CCGGGCACGCTTGATTTACAGAAATCTCGAGATTTCTGTAAATCAAGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013464
VALIDATED
AHR MISSION shRNA Lentiviral Transduction Particles
aryl hydrocarbon receptor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013464.4-938s21c1
Sequence:CCGGCACAGGCAGCAGTCTATTATACTCGAGTATAATAGACTGCTGCCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013464.4-2070s21c1
Sequence:CCGGCATCGACATAACGGACGAAATCTCGAGATTTCGTCCGTTATGTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013464.4-3856s21c1
Sequence:GTACCGGGTCAAGCCTGTTAGCTATATTCTCGAGAATATAGCTAACAGGCTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013464.4-1926s21c1
Sequence:CCGGAGAGCTCTTTCCGGATAATAACTCGAGTTATTATCCGGAAAGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013464.4-817s21c1
Sequence:CCGGGTCATCCATCAGAGCGTATATCTCGAGATATACGCTCTGATGGATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013464.2-941s1c1
Sequence:CCGGGCTGGATAATTCATCTGGTTTCTCGAGAAACCAGATGAATTATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013464.2-2328s1c1
Sequence:CCGGGCTCAGGAATTTCCCTACAAACTCGAGTTTGTAGGGAAATTCCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013464.2-439s1c1
Sequence:CCGGCCTTCCCGCAAGATGTTATTACTCGAGTAATAACATCTTGCGGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013464.2-1773s1c1
Sequence:CCGGGCGCTGAAACATGAGCAAATTCTCGAGAATTTGCTCATGTTTCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013464.2-1359s1c1
Sequence:CCGGGCACGCTTGATTTACAGAAATCTCGAGATTTCTGTAAATCAAGCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)