EMAIL THIS PAGE TO A FRIEND

AK8

adenylate kinase 8

51 Gene Product Result for
Synonyms: AK 8 C9orf98 DDX31 RP11-143F18.1
UniProtKB ID: Q96MA6, A8K821, Q8N9W9
Gene ID:
Mouse(68870) adenylate kinase 8
Rat(311833) adenylate kinase 8
Zebrafish(553671) adenylate kinase 8
chicken(430522) adenylate kinase 8
dog(480689) adenylate kinase 8
cow(615606) adenylate kinase 8
Horse(100066634) adenylate kinase 8
domestic cat(101101262) adenylate kinase 8
sheep(101113475) adenylate kinase 8
domestic guinea pig(100726292) adenylate kinase 8
naked mole-rat(101704809) adenylate kinase 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033874 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033874 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033874 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152572 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152572 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152572 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_130050 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_130050 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_130050 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152572 Rosetta Predictions human pricing
NM_001004266 Rosetta Predictions rat pricing
NM_001033874 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082234 predicted 1440
2 SASI_Hs01_00082235 predicted 1095
3 SASI_Hs01_00082236 predicted 1127
4 SASI_Hs01_00082237 predicted 1661
5 SASI_Hs01_00082238 predicted 1420
6 SASI_Hs02_00366387 predicted 1693
7 SASI_Hs01_00082239 predicted 720
8 SASI_Hs01_00082240 predicted 1874
9 SASI_Hs02_00366388 predicted 1678
10 SASI_Hs01_00082242 predicted 1206
11 SASI_Hs01_00082241 predicted 1127
12 SASI_Hs01_00082243 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088688 predicted 1303
2 SASI_Rn01_00088689 predicted 1280
3 SASI_Rn01_00088690 predicted 1207
4 SASI_Rn01_00088691 predicted 1031
5 SASI_Rn01_00088692 predicted 778
6 SASI_Rn02_00198287 predicted 625
7 SASI_Rn01_00088693 predicted 338
8 SASI_Rn01_00088694 predicted 283
9 SASI_Rn01_00088695 predicted 741
10 SASI_Rn01_00088696 predicted 996
11 SASI_Rn01_00088697 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091771 predicted 1026
2 SASI_Mm01_00091772 predicted 1044
3 SASI_Mm01_00091773 predicted 1294
4 SASI_Mm01_00091775 predicted 364
5 SASI_Mm02_00289018 predicted 508
6 SASI_Mm01_00091776 predicted 1219
7 SASI_Mm01_00091777 predicted 1130
8 SASI_Mm01_00091778 predicted 895
9 SASI_Mm01_00091779 predicted 338
10 SASI_Mm01_00091780 predicted 510
11 SASI_Mm01_00091774 predicted 673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033874
AK8 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 8
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033874.2-1367s21c1
Sequence:CCGGACTACGATCGAGCCATCATTGCTCGAGCAATGATGGCTCGATCGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033874.2-255s21c1
Sequence:CCGGGTGGCTCTGCAAACATCTAAACTCGAGTTTAGATGTTTGCAGAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033874.2-884s21c1
Sequence:CCGGCTACCCTTCTGGCCCAGAAATCTCGAGATTTCTGGGCCAGAAGGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033874.2-199s21c1
Sequence:CCGGGTGCCGAAGGTTGTGATATTACTCGAGTAATATCACAACCTTCGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033874
AK8 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 8
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033874.2-1367s21c1
Sequence:CCGGACTACGATCGAGCCATCATTGCTCGAGCAATGATGGCTCGATCGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033874.2-255s21c1
Sequence:CCGGGTGGCTCTGCAAACATCTAAACTCGAGTTTAGATGTTTGCAGAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033874.2-884s21c1
Sequence:CCGGCTACCCTTCTGGCCCAGAAATCTCGAGATTTCTGGGCCAGAAGGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033874.2-199s21c1
Sequence:CCGGGTGCCGAAGGTTGTGATATTACTCGAGTAATATCACAACCTTCGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033874
AK8 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 8
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033874.2-1367s21c1
Sequence:CCGGACTACGATCGAGCCATCATTGCTCGAGCAATGATGGCTCGATCGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033874.2-255s21c1
Sequence:CCGGGTGGCTCTGCAAACATCTAAACTCGAGTTTAGATGTTTGCAGAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033874.2-884s21c1
Sequence:CCGGCTACCCTTCTGGCCCAGAAATCTCGAGATTTCTGGGCCAGAAGGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033874.2-199s21c1
Sequence:CCGGGTGCCGAAGGTTGTGATATTACTCGAGTAATATCACAACCTTCGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152572
VALIDATED
AK8 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152572.2-1023s21c1
Sequence:CCGGTCACACCCAGACACGTCATTGCTCGAGCAATGACGTGTCTGGGTGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152572.2-1328s21c1
Sequence:CCGGCAAAGCAACCATCGTACTAATCTCGAGATTAGTACGATGGTTGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152572.2-1951s21c1
Sequence:CCGGCATCGAGAGTGGGATCATTAACTCGAGTTAATGATCCCACTCTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152572.2-1877s1c1
Sequence:CCGGGCTGACTTGGAGCAGTTGTATCTCGAGATACAACTGCTCCAAGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_152572.2-697s1c1
Sequence:CCGGCCAGCACTTGCATAGAGACAACTCGAGTTGTCTCTATGCAAGTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_152572.2-1099s1c1
Sequence:CCGGCCCTCAAACTGGAGAGATTTACTCGAGTAAATCTCTCCAGTTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_152572.2-1721s1c1
Sequence:CCGGCTGACTCTGAGAAGAATTGATCTCGAGATCAATTCTTCTCAGAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_152572.2-700s1c1
Sequence:CCGGGCACTTGCATAGAGACAACGACTCGAGTCGTTGTCTCTATGCAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152572
VALIDATED
AK8 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152572.2-1023s21c1
Sequence:CCGGTCACACCCAGACACGTCATTGCTCGAGCAATGACGTGTCTGGGTGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152572.2-1328s21c1
Sequence:CCGGCAAAGCAACCATCGTACTAATCTCGAGATTAGTACGATGGTTGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152572.2-1951s21c1
Sequence:CCGGCATCGAGAGTGGGATCATTAACTCGAGTTAATGATCCCACTCTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152572.2-1877s1c1
Sequence:CCGGGCTGACTTGGAGCAGTTGTATCTCGAGATACAACTGCTCCAAGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_152572.2-697s1c1
Sequence:CCGGCCAGCACTTGCATAGAGACAACTCGAGTTGTCTCTATGCAAGTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_152572.2-1099s1c1
Sequence:CCGGCCCTCAAACTGGAGAGATTTACTCGAGTAAATCTCTCCAGTTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_152572.2-1721s1c1
Sequence:CCGGCTGACTCTGAGAAGAATTGATCTCGAGATCAATTCTTCTCAGAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_152572.2-700s1c1
Sequence:CCGGGCACTTGCATAGAGACAACGACTCGAGTCGTTGTCTCTATGCAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152572
VALIDATED
AK8 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152572.2-1023s21c1
Sequence:CCGGTCACACCCAGACACGTCATTGCTCGAGCAATGACGTGTCTGGGTGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152572.2-1328s21c1
Sequence:CCGGCAAAGCAACCATCGTACTAATCTCGAGATTAGTACGATGGTTGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152572.2-1951s21c1
Sequence:CCGGCATCGAGAGTGGGATCATTAACTCGAGTTAATGATCCCACTCTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152572.2-1877s1c1
Sequence:CCGGGCTGACTTGGAGCAGTTGTATCTCGAGATACAACTGCTCCAAGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_152572.2-697s1c1
Sequence:CCGGCCAGCACTTGCATAGAGACAACTCGAGTTGTCTCTATGCAAGTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_152572.2-1099s1c1
Sequence:CCGGCCCTCAAACTGGAGAGATTTACTCGAGTAAATCTCTCCAGTTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_152572.2-1721s1c1
Sequence:CCGGCTGACTCTGAGAAGAATTGATCTCGAGATCAATTCTTCTCAGAGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_152572.2-700s1c1
Sequence:CCGGGCACTTGCATAGAGACAACGACTCGAGTCGTTGTCTCTATGCAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_130050
AK8 MISSION shRNA Bacterial Glycerol Stock
adenylate kinase 8
Mouse
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000024653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130050.2-350s1c1
Sequence:CCGGGTTTACAAGAAGATTCCCAATCTCGAGATTGGGAATCTTCTTGTAAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_130050
AK8 MISSION shRNA shRNA Plasmid DNA
adenylate kinase 8
Mouse
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000024653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130050.2-350s1c1
Sequence:CCGGGTTTACAAGAAGATTCCCAATCTCGAGATTGGGAATCTTCTTGTAAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_130050
AK8 MISSION shRNA Lentiviral Transduction Particles
adenylate kinase 8
Mouse
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000024653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130050.2-350s1c1
Sequence:CCGGGTTTACAAGAAGATTCCCAATCTCGAGATTGGGAATCTTCTTGTAAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)