EMAIL THIS PAGE TO A FRIEND

AKAP14

A kinase (PRKA) anchor protein 14

79 Gene Product Result for
Synonyms: AKAP28 PRKA14
UniProtKB ID: Q86UN6, Q86UN4, Q86UN5
Gene ID:
Human(158798) Summary: The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The protein anchors PKA in ciliary axonemes and, in this way, may play a role in regulating ciliary beat frequency. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(434756) A kinase (PRKA) anchor protein 14
Rat(60332) A kinase (PRKA) anchor protein 14
sheep(101104814) A kinase (PRKA) anchor protein 14
naked mole-rat(101701383) A kinase (PRKA) anchor protein 14
chicken(772147) A kinase (PRKA) anchor protein 14
cow(100296237) A kinase (PRKA) anchor protein 14
domestic cat(101093340) A kinase (PRKA) anchor protein 14
dog(611085) A kinase (PRKA) anchor protein 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178813 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_486648 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_486648 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_486648 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008534 Rosetta Predictions human pricing
NM_001008535 Rosetta Predictions human pricing
NM_178813 Rosetta Predictions human pricing
NM_021703 Rosetta Predictions rat pricing
NM_001033785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123559 predicted 400
2 SASI_Hs01_00123560 predicted 328
3 SASI_Hs01_00123561 predicted 248
4 SASI_Hs01_00123562 predicted 232
5 SASI_Hs01_00123563 predicted 363
6 SASI_Hs01_00123564 predicted 396
7 SASI_Hs01_00123565 predicted 340
8 SASI_Hs01_00123566 predicted 229
9 SASI_Hs01_00123567 predicted 434
10 SASI_Hs01_00123568 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093456 predicted 229
2 SASI_Hs01_00093457 predicted 231
3 SASI_Hs02_00305491 predicted 219
4 SASI_Hs01_00093458 predicted 225
5 SASI_Hs01_00093459 predicted 227
6 SASI_Hs01_00093460 predicted 194
7 SASI_Hs01_00093461 predicted 204
8 SASI_Hs01_00093462 predicted 234
9 SASI_Hs01_00093463 predicted 203
10 SASI_Hs01_00093465 predicted 218
11 SASI_Hs01_00093464 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128412 predicted 524
2 SASI_Hs01_00128413 predicted 527
3 SASI_Hs01_00128414 predicted 248
4 SASI_Hs01_00128415 predicted 233
5 SASI_Hs01_00128416 predicted 577
6 SASI_Hs01_00128417 predicted 298
7 SASI_Hs01_00128418 predicted 223
8 SASI_Hs01_00128419 predicted 577
9 SASI_Hs01_00128420 predicted 517
10 SASI_Hs02_00369854 predicted 583
11 SASI_Hs01_00128411 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074842 predicted 1171
2 SASI_Rn01_00074845 predicted 560
3 SASI_Rn01_00074846 predicted 1590
4 SASI_Rn01_00074847 predicted 1592
5 SASI_Rn01_00074848 predicted 1197
6 SASI_Rn01_00074850 predicted 1118
7 SASI_Rn02_00262751 predicted 646
8 SASI_Rn02_00262752 predicted 1276
9 SASI_Rn02_00262753 predicted 1121
10 SASI_Rn02_00262754 predicted 644
11 SASI_Rn01_00074841 predicted 1561
12 SASI_Rn01_00074843 predicted 660
13 SASI_Rn01_00074844 predicted 592
14 SASI_Rn01_00074849 predicted 1626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116263 predicted 968
2 SASI_Mm01_00116264 predicted 406
3 SASI_Mm01_00116265 predicted 1536
4 SASI_Mm01_00116266 predicted 1223
5 SASI_Mm01_00116267 predicted 1126
6 SASI_Mm01_00116268 predicted 1545
7 SASI_Mm01_00116269 predicted 1035
8 SASI_Mm01_00116270 predicted 1502
9 SASI_Mm01_00116271 predicted 1065
10 SASI_Mm01_00116272 predicted 1497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178813
AKAP14 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 14
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178813.5-276s21c1
Sequence:CCGGTGTCATCAATTATGCTGTTAACTCGAGTTAACAGCATAATTGATGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178813.5-467s21c1
Sequence:CCGGGCTTCCTCTACATCTACTATGCTCGAGCATAGTAGATGTAGAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178813.5-298s21c1
Sequence:CCGGATTGTGGAAGAGGAGCGAAACCTCGAGGTTTCGCTCCTCTTCCACAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178813.5-441s21c1
Sequence:CCGGTGTAGAGAGGAAAGACTTAATCTCGAGATTAAGTCTTTCCTCTCTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178813.4-720s1c1
Sequence:CCGGGCACCCATTGTTGTTTCTTATCTCGAGATAAGAAACAACAATGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178813.4-333s1c1
Sequence:CCGGGCAAGCCAAACAATGCCGAATCTCGAGATTCGGCATTGTTTGGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178813.4-820s1c1
Sequence:CCGGCCAAATATAGTTTCATGGAGTCTCGAGACTCCATGAAACTATATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178813.4-347s1c1
Sequence:CCGGGCCGAATACACAAGACAAGAACTCGAGTTCTTGTCTTGTGTATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178813.4-309s1c1
Sequence:CCGGGCAATGGATGAGGATAACAAACTCGAGTTTGTTATCCTCATCCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178813
AKAP14 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 14
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178813.5-276s21c1
Sequence:CCGGTGTCATCAATTATGCTGTTAACTCGAGTTAACAGCATAATTGATGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178813.5-467s21c1
Sequence:CCGGGCTTCCTCTACATCTACTATGCTCGAGCATAGTAGATGTAGAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178813.5-298s21c1
Sequence:CCGGATTGTGGAAGAGGAGCGAAACCTCGAGGTTTCGCTCCTCTTCCACAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178813.5-441s21c1
Sequence:CCGGTGTAGAGAGGAAAGACTTAATCTCGAGATTAAGTCTTTCCTCTCTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178813.4-720s1c1
Sequence:CCGGGCACCCATTGTTGTTTCTTATCTCGAGATAAGAAACAACAATGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178813.4-333s1c1
Sequence:CCGGGCAAGCCAAACAATGCCGAATCTCGAGATTCGGCATTGTTTGGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178813.4-820s1c1
Sequence:CCGGCCAAATATAGTTTCATGGAGTCTCGAGACTCCATGAAACTATATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178813.4-347s1c1
Sequence:CCGGGCCGAATACACAAGACAAGAACTCGAGTTCTTGTCTTGTGTATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178813.4-309s1c1
Sequence:CCGGGCAATGGATGAGGATAACAAACTCGAGTTTGTTATCCTCATCCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178813
AKAP14 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 14
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178813.5-276s21c1
Sequence:CCGGTGTCATCAATTATGCTGTTAACTCGAGTTAACAGCATAATTGATGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178813.5-467s21c1
Sequence:CCGGGCTTCCTCTACATCTACTATGCTCGAGCATAGTAGATGTAGAGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178813.5-298s21c1
Sequence:CCGGATTGTGGAAGAGGAGCGAAACCTCGAGGTTTCGCTCCTCTTCCACAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178813.5-441s21c1
Sequence:CCGGTGTAGAGAGGAAAGACTTAATCTCGAGATTAAGTCTTTCCTCTCTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178813.4-720s1c1
Sequence:CCGGGCACCCATTGTTGTTTCTTATCTCGAGATAAGAAACAACAATGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178813.4-333s1c1
Sequence:CCGGGCAAGCCAAACAATGCCGAATCTCGAGATTCGGCATTGTTTGGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178813.4-820s1c1
Sequence:CCGGCCAAATATAGTTTCATGGAGTCTCGAGACTCCATGAAACTATATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178813.4-347s1c1
Sequence:CCGGGCCGAATACACAAGACAAGAACTCGAGTTCTTGTCTTGTGTATTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178813.4-309s1c1
Sequence:CCGGGCAATGGATGAGGATAACAAACTCGAGTTTGTTATCCTCATCCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033785
AKAP14 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 14
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000362999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033785.2-1601s21c1
Sequence:CCGGGACCAGGAGAAATTCGATTTCCTCGAGGAAATCGAATTTCTCCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033785.2-1038s21c1
Sequence:CCGGACTACGTGTGCCCGAGTTAAACTCGAGTTTAACTCGGGCACACGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033785.2-1230s21c1
Sequence:CCGGGACTGTAGTGGACGGCGTAATCTCGAGATTACGCCGTCCACTACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033785
AKAP14 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 14
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000362999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033785.2-1601s21c1
Sequence:CCGGGACCAGGAGAAATTCGATTTCCTCGAGGAAATCGAATTTCTCCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033785.2-1038s21c1
Sequence:CCGGACTACGTGTGCCCGAGTTAAACTCGAGTTTAACTCGGGCACACGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033785.2-1230s21c1
Sequence:CCGGGACTGTAGTGGACGGCGTAATCTCGAGATTACGCCGTCCACTACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033785
AKAP14 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 14
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000362999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033785.2-1601s21c1
Sequence:CCGGGACCAGGAGAAATTCGATTTCCTCGAGGAAATCGAATTTCTCCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033785.2-1038s21c1
Sequence:CCGGACTACGTGTGCCCGAGTTAAACTCGAGTTTAACTCGGGCACACGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033785.2-1230s21c1
Sequence:CCGGGACTGTAGTGGACGGCGTAATCTCGAGATTACGCCGTCCACTACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_486648
AKAP14 MISSION shRNA Bacterial Glycerol Stock
A kinase (PRKA) anchor protein 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486648.1-1554s1c1
Sequence:CCGGGCCTGTTGATGTCTCTTACATCTCGAGATGTAAGAGACATCAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486648.1-469s1c1
Sequence:CCGGCCAGTAGTAGTGCCTGAAGTACTCGAGTACTTCAGGCACTACTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486648.1-176s1c1
Sequence:CCGGCCAAGCATGTTACAGAGCCAACTCGAGTTGGCTCTGTAACATGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486648.1-1388s1c1
Sequence:CCGGGCTGGGTGTATTATGCTGATTCTCGAGAATCAGCATAATACACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486648.1-1047s1c1
Sequence:CCGGGCCCGAGTTAAAGGAAATCAACTCGAGTTGATTTCCTTTAACTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_486648
AKAP14 MISSION shRNA shRNA Plasmid DNA
A kinase (PRKA) anchor protein 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486648.1-1554s1c1
Sequence:CCGGGCCTGTTGATGTCTCTTACATCTCGAGATGTAAGAGACATCAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486648.1-469s1c1
Sequence:CCGGCCAGTAGTAGTGCCTGAAGTACTCGAGTACTTCAGGCACTACTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486648.1-176s1c1
Sequence:CCGGCCAAGCATGTTACAGAGCCAACTCGAGTTGGCTCTGTAACATGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486648.1-1388s1c1
Sequence:CCGGGCTGGGTGTATTATGCTGATTCTCGAGAATCAGCATAATACACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486648.1-1047s1c1
Sequence:CCGGGCCCGAGTTAAAGGAAATCAACTCGAGTTGATTTCCTTTAACTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_486648
AKAP14 MISSION shRNA Lentiviral Transduction Particles
A kinase (PRKA) anchor protein 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486648.1-1554s1c1
Sequence:CCGGGCCTGTTGATGTCTCTTACATCTCGAGATGTAAGAGACATCAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486648.1-469s1c1
Sequence:CCGGCCAGTAGTAGTGCCTGAAGTACTCGAGTACTTCAGGCACTACTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486648.1-176s1c1
Sequence:CCGGCCAAGCATGTTACAGAGCCAACTCGAGTTGGCTCTGTAACATGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486648.1-1388s1c1
Sequence:CCGGGCTGGGTGTATTATGCTGATTCTCGAGAATCAGCATAATACACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486648.1-1047s1c1
Sequence:CCGGGCCCGAGTTAAAGGAAATCAACTCGAGTTGATTTCCTTTAACTCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)