EMAIL THIS PAGE TO A FRIEND

ALDH2

aldehyde dehydrogenase 2 family (mitochondrial)

57 Gene Product Result for
Synonyms: ALDH-E2 ALDHI ALDM
UniProtKB ID: P05091, B4DW54, E7EUE5, Q03639, Q6IB13, Q6IV71
Gene ID:
Human(217) Summary: This protein belongs to the aldehyde dehydrogenase family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. Two major liver isoforms of aldehyde dehydrogenase, cytosolic and mitochondrial, can be distinguished by their electrophoretic mobilities, kinetic properties, and subcellular localizations. Most Caucasians have two major isozymes, while approximately 50% of Orientals have the cytosolic isozyme but not the mitochondrial isozyme. A remarkably higher frequency of acute alcohol intoxication among Orientals than among Caucasians could be related to the absence of a catalytically active form of the mitochondrial isozyme. The increased exposure to acetaldehyde in individuals with the catalytically inactive form may also confer greater susceptibility to many types of cancer. This gene encodes a mitochondrial isoform, which has a low Km for acetaldehydes, and is localized in mitochondrial matrix. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Mar 2011]
Mouse(11669) aldehyde dehydrogenase 2, mitochondrial
Rat(29539) aldehyde dehydrogenase 2 family (mitochondrial)
sheep(101116511) aldehyde dehydrogenase 2 family (mitochondrial)
Domestic Rabbit(100338523) aldehyde dehydrogenase 2 family (mitochondrial)
domestic guinea pig(100730314) aldehyde dehydrogenase 2 family (mitochondrial)
naked mole-rat(101706449) aldehyde dehydrogenase 2 family (mitochondrial)
chicken(416880) aldehyde dehydrogenase 2 family (mitochondrial)
dog(610941) aldehyde dehydrogenase 2 family (mitochondrial)
cow(508629) aldehyde dehydrogenase 2 family (mitochondrial)
domestic cat(101082267) aldehyde dehydrogenase 2 family (mitochondrial)
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009656 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009656 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009656 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000690 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000690 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000690 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000690 Rosetta Predictions human pricing
NM_032416 Rosetta Predictions rat pricing
NM_009656 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098256 predicted 981
2 SASI_Hs01_00098257 predicted 1088
3 SASI_Hs01_00098259 predicted 1231
4 SASI_Hs01_00098260 predicted 858
5 SASI_Hs01_00098261 predicted 1041
6 SASI_Hs02_00303093 predicted 1960
7 SASI_Hs01_00098262 predicted 850
8 SASI_Hs01_00098263 predicted 893
9 SASI_Hs01_00098264 predicted 1318
10 SASI_Hs01_00098265 predicted 858
11 SASI_Hs01_00098258 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032416 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096060 predicted 490
2 SASI_Rn01_00096063 predicted 1118
3 SASI_Rn01_00096064 predicted 515
4 SASI_Rn01_00096065 predicted 383
5 SASI_Rn01_00096066 predicted 680
6 SASI_Rn01_00096067 predicted 1238
7 SASI_Rn01_00096068 predicted 570
8 SASI_Rn01_00096069 predicted 566
9 SASI_Rn02_00265474 predicted 447
10 SASI_Rn02_00265475 predicted 1549
11 SASI_Rn01_00096061 predicted 343
12 SASI_Rn01_00096062 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009656 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117307 predicted 1604
2 SASI_Mm01_00117308 predicted 799
3 SASI_Mm01_00117309 predicted 551
4 SASI_Mm01_00117310 predicted 769
5 SASI_Mm01_00117311 predicted 1203
6 SASI_Mm02_00316659 predicted 1869
7 SASI_Mm01_00117313 predicted 1328
8 SASI_Mm01_00117314 predicted 1855
9 SASI_Mm01_00117315 predicted 1832
10 SASI_Mm01_00117316 predicted 1220
11 SASI_Mm01_00117312 predicted 1364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009656
VALIDATED
ALDH2 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 2 family (mitochondrial)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009656.1-537s1c1
Sequence:CCGGCCTGAAATGTCTCCGCTATTACTCGAGTAATAGCGGAGACATTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009656.1-1081s1c1
Sequence:CCGGCGGACCTTCGTGCAGGAGAATCTCGAGATTCTCCTGCACGAAGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009656.1-568s1c1
Sequence:CCGGGCTGACAAGTACCATGGGAAACTCGAGTTTCCCATGGTACTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009656.1-1369s1c1
Sequence:CCGGCCAGTGATGCAAATCCTCAAACTCGAGTTTGAGGATTTGCATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009656.1-1417s1c1
Sequence:CCGGCGGGCCAATGATTCTAAGTATCTCGAGATACTTAGAATCATTGGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009656.3-1655s21c1
Sequence:CCGGCGGGCCAATGATTCTAAGTATCTCGAGATACTTAGAATCATTGGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009656.3-775s21c1
Sequence:CCGGCCTGAAATGTCTCCGCTATTACTCGAGTAATAGCGGAGACATTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009656.3-1607s21c1
Sequence:CCGGCCAGTGATGCAAATCCTCAAACTCGAGTTTGAGGATTTGCATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009656.3-806s21c1
Sequence:CCGGGCTGACAAGTACCATGGGAAACTCGAGTTTCCCATGGTACTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009656.3-1319s21c1
Sequence:CCGGCGGACCTTCGTGCAGGAGAATCTCGAGATTCTCCTGCACGAAGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009656
VALIDATED
ALDH2 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 2 family (mitochondrial)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009656.1-537s1c1
Sequence:CCGGCCTGAAATGTCTCCGCTATTACTCGAGTAATAGCGGAGACATTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009656.1-1081s1c1
Sequence:CCGGCGGACCTTCGTGCAGGAGAATCTCGAGATTCTCCTGCACGAAGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009656.1-568s1c1
Sequence:CCGGGCTGACAAGTACCATGGGAAACTCGAGTTTCCCATGGTACTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009656.1-1369s1c1
Sequence:CCGGCCAGTGATGCAAATCCTCAAACTCGAGTTTGAGGATTTGCATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009656.1-1417s1c1
Sequence:CCGGCGGGCCAATGATTCTAAGTATCTCGAGATACTTAGAATCATTGGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009656.3-1655s21c1
Sequence:CCGGCGGGCCAATGATTCTAAGTATCTCGAGATACTTAGAATCATTGGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009656.3-775s21c1
Sequence:CCGGCCTGAAATGTCTCCGCTATTACTCGAGTAATAGCGGAGACATTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009656.3-1607s21c1
Sequence:CCGGCCAGTGATGCAAATCCTCAAACTCGAGTTTGAGGATTTGCATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009656.3-806s21c1
Sequence:CCGGGCTGACAAGTACCATGGGAAACTCGAGTTTCCCATGGTACTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009656.3-1319s21c1
Sequence:CCGGCGGACCTTCGTGCAGGAGAATCTCGAGATTCTCCTGCACGAAGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009656
VALIDATED
ALDH2 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 2 family (mitochondrial)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009656.1-537s1c1
Sequence:CCGGCCTGAAATGTCTCCGCTATTACTCGAGTAATAGCGGAGACATTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009656.1-1081s1c1
Sequence:CCGGCGGACCTTCGTGCAGGAGAATCTCGAGATTCTCCTGCACGAAGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009656.1-568s1c1
Sequence:CCGGGCTGACAAGTACCATGGGAAACTCGAGTTTCCCATGGTACTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009656.1-1369s1c1
Sequence:CCGGCCAGTGATGCAAATCCTCAAACTCGAGTTTGAGGATTTGCATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009656.1-1417s1c1
Sequence:CCGGCGGGCCAATGATTCTAAGTATCTCGAGATACTTAGAATCATTGGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009656.3-1655s21c1
Sequence:CCGGCGGGCCAATGATTCTAAGTATCTCGAGATACTTAGAATCATTGGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009656.3-775s21c1
Sequence:CCGGCCTGAAATGTCTCCGCTATTACTCGAGTAATAGCGGAGACATTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009656.3-1607s21c1
Sequence:CCGGCCAGTGATGCAAATCCTCAAACTCGAGTTTGAGGATTTGCATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009656.3-806s21c1
Sequence:CCGGGCTGACAAGTACCATGGGAAACTCGAGTTTCCCATGGTACTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009656.3-1319s21c1
Sequence:CCGGCGGACCTTCGTGCAGGAGAATCTCGAGATTCTCCTGCACGAAGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000690
VALIDATED
ALDH2 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 2 family (mitochondrial)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000690.2-1938s1c1
Sequence:CCGGGCAGGCATACACTGAAGTGAACTCGAGTTCACTTCAGTGTATGCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000690.2-1312s1c1
Sequence:CCGGCCCAACATCATCATGTCAGATCTCGAGATCTGACATGATGATGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000690.2-898s1c1
Sequence:CCGGGCTGATAAGTACCACGGGAAACTCGAGTTTCCCGTGGTACTTATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000690.2-1426s1c1
Sequence:CCGGGAGGACATCTATGATGAGTTTCTCGAGAAACTCATCATAGATGTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000690.2-981s1c1
Sequence:CCGGGCAGATCATTCCGTGGAATTTCTCGAGAAATTCCACGGAATGATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000690
VALIDATED
ALDH2 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 2 family (mitochondrial)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000690.2-1938s1c1
Sequence:CCGGGCAGGCATACACTGAAGTGAACTCGAGTTCACTTCAGTGTATGCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000690.2-1312s1c1
Sequence:CCGGCCCAACATCATCATGTCAGATCTCGAGATCTGACATGATGATGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000690.2-898s1c1
Sequence:CCGGGCTGATAAGTACCACGGGAAACTCGAGTTTCCCGTGGTACTTATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000690.2-1426s1c1
Sequence:CCGGGAGGACATCTATGATGAGTTTCTCGAGAAACTCATCATAGATGTCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000690.2-981s1c1
Sequence:CCGGGCAGATCATTCCGTGGAATTTCTCGAGAAATTCCACGGAATGATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000690
VALIDATED
ALDH2 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 2 family (mitochondrial)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000690.2-1938s1c1
Sequence:CCGGGCAGGCATACACTGAAGTGAACTCGAGTTCACTTCAGTGTATGCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000690.2-1312s1c1
Sequence:CCGGCCCAACATCATCATGTCAGATCTCGAGATCTGACATGATGATGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000690.2-898s1c1
Sequence:CCGGGCTGATAAGTACCACGGGAAACTCGAGTTTCCCGTGGTACTTATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000690.2-1426s1c1
Sequence:CCGGGAGGACATCTATGATGAGTTTCTCGAGAAACTCATCATAGATGTCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000690.2-981s1c1
Sequence:CCGGGCAGATCATTCCGTGGAATTTCTCGAGAAATTCCACGGAATGATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)