EMAIL THIS PAGE TO A FRIEND

ALG1L9P

asparagine-linked glycosylation 1-like 9, pseudogene

3 Gene Product Result for
Species: Human ALG1L9P(285407)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_209597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_209597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_209597 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_209597 Rosetta Predictions human pricing
XR_037680 Rosetta Predictions human pricing
XR_037793 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_209597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267447 predicted 13
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_037680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00502852 predicted 11
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_037793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00503332 predicted 4
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_209597
ALG1L9P MISSION shRNA Bacterial Glycerol Stock
asparagine-linked glycosylation 1-like 9, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209597.5-807s1c1
Sequence:CCGGGCTAAACCAGTTCCGGAAGAACTCGAGTTCTTCCGGAACTGGTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209597.5-52s1c1
Sequence:CCGGCCTTGGAACTACATCATCGCTCTCGAGAGCGATGATGTAGTTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209597.5-53s1c1
Sequence:CCGGCTTGGAACTACATCATCGCTTCTCGAGAAGCGATGATGTAGTTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209597.5-368s1c1
Sequence:CCGGCAGAGGACGAAGACTTCTCTACTCGAGTAGAGAAGTCTTCGTCCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209597.5-63s1c1
Sequence:CCGGCATCATCGCTTGTACAGTGTACTCGAGTACACTGTACAAGCGATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_209597
ALG1L9P MISSION shRNA shRNA Plasmid DNA
asparagine-linked glycosylation 1-like 9, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209597.5-807s1c1
Sequence:CCGGGCTAAACCAGTTCCGGAAGAACTCGAGTTCTTCCGGAACTGGTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209597.5-52s1c1
Sequence:CCGGCCTTGGAACTACATCATCGCTCTCGAGAGCGATGATGTAGTTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209597.5-53s1c1
Sequence:CCGGCTTGGAACTACATCATCGCTTCTCGAGAAGCGATGATGTAGTTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209597.5-368s1c1
Sequence:CCGGCAGAGGACGAAGACTTCTCTACTCGAGTAGAGAAGTCTTCGTCCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209597.5-63s1c1
Sequence:CCGGCATCATCGCTTGTACAGTGTACTCGAGTACACTGTACAAGCGATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_209597
ALG1L9P MISSION shRNA Lentiviral Transduction Particles
asparagine-linked glycosylation 1-like 9, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209597.5-807s1c1
Sequence:CCGGGCTAAACCAGTTCCGGAAGAACTCGAGTTCTTCCGGAACTGGTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209597.5-52s1c1
Sequence:CCGGCCTTGGAACTACATCATCGCTCTCGAGAGCGATGATGTAGTTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209597.5-53s1c1
Sequence:CCGGCTTGGAACTACATCATCGCTTCTCGAGAAGCGATGATGTAGTTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209597.5-368s1c1
Sequence:CCGGCAGAGGACGAAGACTTCTCTACTCGAGTAGAGAAGTCTTCGTCCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_209597.5-63s1c1
Sequence:CCGGCATCATCGCTTGTACAGTGTACTCGAGTACACTGTACAAGCGATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)