EMAIL THIS PAGE TO A FRIEND

ALX4

ALX homeobox 4

81 Gene Product Result for
Synonyms: FND2
UniProtKB ID: Q9H161, Q96JN7, Q9H198, Q9HAY9
Gene ID:
Human(60529) Summary: This gene encodes a paired-like homeodomain transcription factor expressed in the mesenchyme of developing bones, limbs, hair, teeth, and mammary tissue. Mutations in this gene cause parietal foramina 2 (PFM2); an autosomal dominant disease characterized by deficient ossification of the parietal bones. Mutations in this gene also cause a form of frontonasal dysplasia with alopecia and hypogonadism; suggesting a role for this gene in craniofacial development, mesenchymal-epithelial communication, and hair follicle development. Deletion of a segment of chromosome 11 containing this gene, del(11)(p11p12), causes Potocki-Shaffer syndrome (PSS); a syndrome characterized by craniofacial anomalies, mental retardation, multiple exostoses, and genital abnormalities in males. In mouse, this gene has been shown to use dual translation initiation sites located 16 codons apart. [provided by RefSeq, Oct 2009]
Mouse(11695) aristaless-like homeobox 4
Rat(296511) ALX homeobox 4
chicken(373976) ALX homeobox 4
cow(594846) ALX homeobox 4
domestic cat(101083878) ALX homeobox 4
dog(609979) ALX homeobox 4
sheep(101116426) ALX homeobox 4
naked mole-rat(101715465) ALX homeobox 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007442 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007442 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007442 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021926 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU083821 MISSION® esiRNA esiRNA targeting mouse Alx4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021926 Rosetta Predictions human pricing
NM_001106553 Rosetta Predictions rat pricing
NM_007442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146486 predicted 837
2 SASI_Hs01_00146487 predicted 1317
3 SASI_Hs01_00146488 predicted 997
4 SASI_Hs01_00146489 predicted 977
5 SASI_Hs01_00146491 predicted 988
6 SASI_Hs01_00146492 predicted 1165
7 SASI_Hs01_00146493 predicted 1134
8 SASI_Hs01_00146494 predicted 990
9 SASI_Hs01_00146495 predicted 909
10 SASI_Hs02_00355208 predicted 1184
11 SASI_Hs01_00146490 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220088 predicted 1205
2 SASI_Rn02_00220089 predicted 1253
3 SASI_Rn02_00220090 predicted 1023
4 SASI_Rn02_00220091 predicted 974
5 SASI_Rn02_00220092 predicted 1447
6 SASI_Rn02_00220093 predicted 1211
7 SASI_Rn02_00220094 predicted 1440
8 SASI_Rn02_00220095 predicted 1248
9 SASI_Rn02_00220096 predicted 765
10 SASI_Rn02_00220097 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076039 predicted 305
2 SASI_Mm01_00076040 predicted 1221
3 SASI_Mm01_00076041 predicted 763
4 SASI_Mm01_00076042 predicted 1004
5 SASI_Mm01_00076043 predicted 1269
6 SASI_Mm01_00076044 predicted 1236
7 SASI_Mm01_00076045 predicted 858
8 SASI_Mm01_00076046 predicted 1031
9 SASI_Mm01_00076047 predicted 368
10 SASI_Mm01_00076048 predicted 589
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007442
ALX4 MISSION shRNA Bacterial Glycerol Stock
ALX homeobox 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007442.2-652s21c1
Sequence:CCGGGAGTTGCCTCCTGACTCTGAACTCGAGTTCAGAGTCAGGAGGCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007442.2-811s21c1
Sequence:CCGGCGAACCACCTTCACTAGCTACCTCGAGGTAGCTAGTGAAGGTGGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007442.2-1197s21c1
Sequence:CCGGCTCCGACTTCTTGAGTGTCTCCTCGAGGAGACACTCAAGAAGTCGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007442.1-1475s1c1
Sequence:CCGGTCCCACTTGACTCTCCTCTTACTCGAGTAAGAGGAGAGTCAAGTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007442.1-772s1c1
Sequence:CCGGACCGATTCTGAGAGTAACAAACTCGAGTTTGTTACTCTCAGAATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007442.1-276s1c1
Sequence:CCGGCCGGGAAGGTTCGTCGCCTTTCTCGAGAAAGGCGACGAACCTTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007442.1-314s1c1
Sequence:CCGGGCGACAAGTTCGGTACAACTTCTCGAGAAGTTGTACCGAACTTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007442.1-1075s1c1
Sequence:CCGGCCATCCTGGATTGGCAACAATCTCGAGATTGTTGCCAATCCAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007442
ALX4 MISSION shRNA shRNA Plasmid DNA
ALX homeobox 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007442.2-652s21c1
Sequence:CCGGGAGTTGCCTCCTGACTCTGAACTCGAGTTCAGAGTCAGGAGGCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007442.2-811s21c1
Sequence:CCGGCGAACCACCTTCACTAGCTACCTCGAGGTAGCTAGTGAAGGTGGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007442.2-1197s21c1
Sequence:CCGGCTCCGACTTCTTGAGTGTCTCCTCGAGGAGACACTCAAGAAGTCGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007442.1-1475s1c1
Sequence:CCGGTCCCACTTGACTCTCCTCTTACTCGAGTAAGAGGAGAGTCAAGTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007442.1-772s1c1
Sequence:CCGGACCGATTCTGAGAGTAACAAACTCGAGTTTGTTACTCTCAGAATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007442.1-276s1c1
Sequence:CCGGCCGGGAAGGTTCGTCGCCTTTCTCGAGAAAGGCGACGAACCTTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007442.1-314s1c1
Sequence:CCGGGCGACAAGTTCGGTACAACTTCTCGAGAAGTTGTACCGAACTTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007442.1-1075s1c1
Sequence:CCGGCCATCCTGGATTGGCAACAATCTCGAGATTGTTGCCAATCCAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007442
ALX4 MISSION shRNA Lentiviral Transduction Particles
ALX homeobox 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007442.2-652s21c1
Sequence:CCGGGAGTTGCCTCCTGACTCTGAACTCGAGTTCAGAGTCAGGAGGCAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007442.2-811s21c1
Sequence:CCGGCGAACCACCTTCACTAGCTACCTCGAGGTAGCTAGTGAAGGTGGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007442.2-1197s21c1
Sequence:CCGGCTCCGACTTCTTGAGTGTCTCCTCGAGGAGACACTCAAGAAGTCGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007442.1-1475s1c1
Sequence:CCGGTCCCACTTGACTCTCCTCTTACTCGAGTAAGAGGAGAGTCAAGTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007442.1-772s1c1
Sequence:CCGGACCGATTCTGAGAGTAACAAACTCGAGTTTGTTACTCTCAGAATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007442.1-276s1c1
Sequence:CCGGCCGGGAAGGTTCGTCGCCTTTCTCGAGAAAGGCGACGAACCTTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007442.1-314s1c1
Sequence:CCGGGCGACAAGTTCGGTACAACTTCTCGAGAAGTTGTACCGAACTTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007442.1-1075s1c1
Sequence:CCGGCCATCCTGGATTGGCAACAATCTCGAGATTGTTGCCAATCCAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021926
ALX4 MISSION shRNA Bacterial Glycerol Stock
ALX homeobox 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021926.3-1678s21c1
Sequence:CCGGCCATGAGTCAATGCTAGATTTCTCGAGAAATCTAGCATTGACTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021926.3-1412s21c1
Sequence:CCGGCCCACTCGACTTTCCTCTTAGCTCGAGCTAAGAGGAAAGTCGAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021926.3-1607s21c1
Sequence:CCGGTCAGCTTCGCATCCATGATAACTCGAGTTATCATGGATGCGAAGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021926.3-1306s21c1
Sequence:CCGGAGGAGCACAGTGCGGCCATTTCTCGAGAAATGGCCGCACTGTGCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021926.3-556s21c1
Sequence:CCGGAGGTTCCCTGCTACGCTAAAGCTCGAGCTTTAGCGTAGCAGGGAACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021926.1-224s1c1
Sequence:CCGGCGACAAGTTCGGCACAACTTTCTCGAGAAAGTTGTGCCGAACTTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021926.1-725s1c1
Sequence:CCGGAGAGAGCAACAAGGGCAAGAACTCGAGTTCTTGCCCTTGTTGCTCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021926.1-458s1c1
Sequence:CCGGGCAACCGCATCTTTACTTGCACTCGAGTGCAAGTAAAGATGCGGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021926.1-1229s1c1
Sequence:CCGGCCTCAATGGCTACGAGCTTAACTCGAGTTAAGCTCGTAGCCATTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021926.1-993s1c1
Sequence:CCGGGCTGAGAACTACGCCCAGATTCTCGAGAATCTGGGCGTAGTTCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021926
ALX4 MISSION shRNA shRNA Plasmid DNA
ALX homeobox 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021926.3-1678s21c1
Sequence:CCGGCCATGAGTCAATGCTAGATTTCTCGAGAAATCTAGCATTGACTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021926.3-1412s21c1
Sequence:CCGGCCCACTCGACTTTCCTCTTAGCTCGAGCTAAGAGGAAAGTCGAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021926.3-1607s21c1
Sequence:CCGGTCAGCTTCGCATCCATGATAACTCGAGTTATCATGGATGCGAAGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021926.3-1306s21c1
Sequence:CCGGAGGAGCACAGTGCGGCCATTTCTCGAGAAATGGCCGCACTGTGCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021926.3-556s21c1
Sequence:CCGGAGGTTCCCTGCTACGCTAAAGCTCGAGCTTTAGCGTAGCAGGGAACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021926.1-224s1c1
Sequence:CCGGCGACAAGTTCGGCACAACTTTCTCGAGAAAGTTGTGCCGAACTTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021926.1-725s1c1
Sequence:CCGGAGAGAGCAACAAGGGCAAGAACTCGAGTTCTTGCCCTTGTTGCTCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021926.1-458s1c1
Sequence:CCGGGCAACCGCATCTTTACTTGCACTCGAGTGCAAGTAAAGATGCGGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021926.1-1229s1c1
Sequence:CCGGCCTCAATGGCTACGAGCTTAACTCGAGTTAAGCTCGTAGCCATTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021926.1-993s1c1
Sequence:CCGGGCTGAGAACTACGCCCAGATTCTCGAGAATCTGGGCGTAGTTCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021926
ALX4 MISSION shRNA Lentiviral Transduction Particles
ALX homeobox 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021926.3-1678s21c1
Sequence:CCGGCCATGAGTCAATGCTAGATTTCTCGAGAAATCTAGCATTGACTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021926.3-1412s21c1
Sequence:CCGGCCCACTCGACTTTCCTCTTAGCTCGAGCTAAGAGGAAAGTCGAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021926.3-1607s21c1
Sequence:CCGGTCAGCTTCGCATCCATGATAACTCGAGTTATCATGGATGCGAAGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021926.3-1306s21c1
Sequence:CCGGAGGAGCACAGTGCGGCCATTTCTCGAGAAATGGCCGCACTGTGCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021926.3-556s21c1
Sequence:CCGGAGGTTCCCTGCTACGCTAAAGCTCGAGCTTTAGCGTAGCAGGGAACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021926.1-224s1c1
Sequence:CCGGCGACAAGTTCGGCACAACTTTCTCGAGAAAGTTGTGCCGAACTTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021926.1-725s1c1
Sequence:CCGGAGAGAGCAACAAGGGCAAGAACTCGAGTTCTTGCCCTTGTTGCTCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021926.1-458s1c1
Sequence:CCGGGCAACCGCATCTTTACTTGCACTCGAGTGCAAGTAAAGATGCGGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021926.1-1229s1c1
Sequence:CCGGCCTCAATGGCTACGAGCTTAACTCGAGTTAAGCTCGTAGCCATTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021926.1-993s1c1
Sequence:CCGGGCTGAGAACTACGCCCAGATTCTCGAGAATCTGGGCGTAGTTCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)