EMAIL THIS PAGE TO A FRIEND

AMACR

alpha-methylacyl-CoA racemase

123 Gene Product Result for
Synonyms: AMACRD CBAS4 RACE RM
Gene ID:
Human(23600) Summary: This gene encodes a racemase. The encoded enzyme interconverts pristanoyl-CoA and C27-bile acylCoAs between their (R)- and (S)-stereoisomers. The conversion to the (S)-stereoisomers is necessary for degradation of these substrates by peroxisomal beta-oxidation. Encoded proteins from this locus localize to both mitochondria and peroxisomes. Mutations in this gene may be associated with adult-onset sensorimotor neuropathy, pigmentary retinopathy, and adrenomyeloneuropathy due to defects in bile acid synthesis. Alternatively spliced transcript variants have been described. Read-through transcription also exists between this gene and the upstream neighboring C1QTNF3 (C1q and tumor necrosis factor related protein 3) gene. [provided by RefSeq, Mar 2011]
Mouse(17117) alpha-methylacyl-CoA racemase
Rat(25284) alpha-methylacyl-CoA racemase
chicken(427429) alpha-methylacyl-CoA racemase
dog(612603) alpha-methylacyl-CoA racemase
domestic cat(101081866) alpha-methylacyl-CoA racemase
Horse(100054088) alpha-methylacyl-CoA racemase
cow(540376) alpha-methylacyl-CoA racemase
naked mole-rat(101718677) alpha-methylacyl-CoA racemase
domestic guinea pig(100715601) alpha-methylacyl-CoA racemase
sheep(101113530) alpha-methylacyl-CoA racemase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014324 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014324 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014324 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008537 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008537 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008537 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014324 Rosetta Predictions human pricing
NM_203382 Rosetta Predictions human pricing
NM_012816 Rosetta Predictions rat pricing
NM_008537 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189298 predicted 831
2 SASI_Hs01_00189299 predicted 1278
3 SASI_Hs02_00345439 predicted 1265
4 SASI_Hs01_00189300 predicted 882
5 SASI_Hs02_00345440 predicted 1149
6 SASI_Hs01_00189301 predicted 1374
7 SASI_Hs01_00189304 predicted 1436
8 SASI_Hs01_00189305 predicted 1259
9 SASI_Hs01_00189306 predicted 1301
10 SASI_Hs01_00189307 predicted 1454
11 SASI_Hs01_00189302 predicted 1476
12 SASI_Hs01_00189303 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076119 predicted 674
2 SASI_Hs01_00076120 predicted 1103
3 SASI_Hs01_00076121 predicted 1002
4 SASI_Hs01_00076122 predicted 1002
5 SASI_Hs01_00076123 predicted 794
6 SASI_Hs02_00373316 predicted 1075
7 SASI_Hs01_00076124 predicted 696
8 SASI_Hs01_00076125 predicted 696
9 SASI_Hs01_00076126 predicted 857
10 SASI_Hs01_00076127 predicted 755
11 SASI_Hs01_00076128 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045621 predicted 1037
2 SASI_Rn01_00045622 predicted 1101
3 SASI_Rn01_00045623 predicted 724
4 SASI_Rn01_00045624 predicted 793
5 SASI_Rn01_00045625 predicted 680
6 SASI_Rn01_00045626 predicted 640
7 SASI_Rn01_00045627 predicted 764
8 SASI_Rn01_00045628 predicted 551
9 SASI_Rn01_00045629 predicted 1212
10 SASI_Rn02_00260266 predicted 809
11 SASI_Rn01_00045630 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008537 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314131 predicted 817
2 SASI_Mm01_00138211 predicted 1190
3 SASI_Mm01_00138212 predicted 884
4 SASI_Mm01_00138213 predicted 367
5 SASI_Mm02_00314132 predicted 658
6 SASI_Mm01_00138214 predicted 1101
7 SASI_Mm01_00138215 predicted 1278
8 SASI_Mm01_00138216 predicted 864
9 SASI_Mm01_00138217 predicted 430
10 SASI_Mm01_00138218 predicted 656
11 SASI_Mm01_00138209 predicted 1264
12 SASI_Mm01_00138210 predicted 833
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014324
VALIDATED
AMACR MISSION shRNA Bacterial Glycerol Stock
alpha-methylacyl-CoA racemase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014324.4-1620s1c1
Sequence:CCGGCCACAAATTGTATGGTGATAACTCGAGTTATCACCATACAATTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014324.4-1131s1c1
Sequence:CCGGCTGAGGAGATACTTGAAGAATCTCGAGATTCTTCAAGTATCTCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014324.4-612s1c1
Sequence:CCGGGTCAGGTCATTGATGCAAATACTCGAGTATTTGCATCAATGACCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014324.4-1165s1c1
Sequence:CCGGCGAAGAGATTTATCAGCTTAACTCGAGTTAAGCTGATAAATCTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014324.4-566s1c1
Sequence:CCGGCTGGGCATTATAATGGCTCTTCTCGAGAAGAGCCATTATAATGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014324.5-1445s21c1
Sequence:CCGGACTTTGGGTACTTATACTAAACTCGAGTTTAGTATAAGTACCCAAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014324.5-745s21c1
Sequence:CCGGGCACCTTTCTATACGACTTACCTCGAGGTAAGTCGTATAGAAAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014324.5-1292s21c1
Sequence:CCGGGTAGAGTAACACATAACATTGCTCGAGCAATGTTATGTGTTACTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014324
VALIDATED
AMACR MISSION shRNA shRNA Plasmid DNA
alpha-methylacyl-CoA racemase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014324.4-1620s1c1
Sequence:CCGGCCACAAATTGTATGGTGATAACTCGAGTTATCACCATACAATTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014324.4-1131s1c1
Sequence:CCGGCTGAGGAGATACTTGAAGAATCTCGAGATTCTTCAAGTATCTCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014324.4-612s1c1
Sequence:CCGGGTCAGGTCATTGATGCAAATACTCGAGTATTTGCATCAATGACCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014324.4-1165s1c1
Sequence:CCGGCGAAGAGATTTATCAGCTTAACTCGAGTTAAGCTGATAAATCTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014324.4-566s1c1
Sequence:CCGGCTGGGCATTATAATGGCTCTTCTCGAGAAGAGCCATTATAATGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014324.5-1445s21c1
Sequence:CCGGACTTTGGGTACTTATACTAAACTCGAGTTTAGTATAAGTACCCAAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014324.5-745s21c1
Sequence:CCGGGCACCTTTCTATACGACTTACCTCGAGGTAAGTCGTATAGAAAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014324.5-1292s21c1
Sequence:CCGGGTAGAGTAACACATAACATTGCTCGAGCAATGTTATGTGTTACTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014324
VALIDATED
AMACR MISSION shRNA Lentiviral Transduction Particles
alpha-methylacyl-CoA racemase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014324.4-1620s1c1
Sequence:CCGGCCACAAATTGTATGGTGATAACTCGAGTTATCACCATACAATTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014324.4-1131s1c1
Sequence:CCGGCTGAGGAGATACTTGAAGAATCTCGAGATTCTTCAAGTATCTCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014324.4-612s1c1
Sequence:CCGGGTCAGGTCATTGATGCAAATACTCGAGTATTTGCATCAATGACCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014324.4-1165s1c1
Sequence:CCGGCGAAGAGATTTATCAGCTTAACTCGAGTTAAGCTGATAAATCTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014324.4-566s1c1
Sequence:CCGGCTGGGCATTATAATGGCTCTTCTCGAGAAGAGCCATTATAATGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014324.5-1445s21c1
Sequence:CCGGACTTTGGGTACTTATACTAAACTCGAGTTTAGTATAAGTACCCAAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014324.5-745s21c1
Sequence:CCGGGCACCTTTCTATACGACTTACCTCGAGGTAAGTCGTATAGAAAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014324.5-1292s21c1
Sequence:CCGGGTAGAGTAACACATAACATTGCTCGAGCAATGTTATGTGTTACTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008537
VALIDATED
AMACR MISSION shRNA Bacterial Glycerol Stock
alpha-methylacyl-CoA racemase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008537.3-410s1c1
Sequence:CCGGGCTGGCCATGACATCAACTATCTCGAGATAGTTGATGTCATGGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008537.3-2016s1c1
Sequence:CCGGCCGGAAGACTTCGTACTGAATCTCGAGATTCAGTACGAAGTCTTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008537.3-905s1c1
Sequence:CCGGCAGATCTTTGACGGGACAGATCTCGAGATCTGTCCCGTCAAAGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008537.3-2391s1c1
Sequence:CCGGCGATTCTGTTTGTCTTGACTTCTCGAGAAGTCAAGACAAACAGAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008537.4-377s21c1
Sequence:CCGGGATTTGGCCAATCGGGAATTTCTCGAGAAATTCCCGATTGGCCAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008537.4-411s21c1
Sequence:CCGGTGGCCATGACATCAACTATTTCTCGAGAAATAGTTGATGTCATGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008537.4-1450s21c1
Sequence:CCGGTGGTGAAGTGTATCCATTTATCTCGAGATAAATGGATACACTTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008537.4-770s21c1
Sequence:CCGGTCTATGCACTGCTGCTTAAAGCTCGAGCTTTAAGCAGCAGTGCATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008537.4-893s21c1
Sequence:CCGGCAGAATGGTGCCAGATCTTTGCTCGAGCAAAGATCTGGCACCATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008537
VALIDATED
AMACR MISSION shRNA shRNA Plasmid DNA
alpha-methylacyl-CoA racemase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008537.3-410s1c1
Sequence:CCGGGCTGGCCATGACATCAACTATCTCGAGATAGTTGATGTCATGGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008537.3-2016s1c1
Sequence:CCGGCCGGAAGACTTCGTACTGAATCTCGAGATTCAGTACGAAGTCTTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008537.3-905s1c1
Sequence:CCGGCAGATCTTTGACGGGACAGATCTCGAGATCTGTCCCGTCAAAGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008537.3-2391s1c1
Sequence:CCGGCGATTCTGTTTGTCTTGACTTCTCGAGAAGTCAAGACAAACAGAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008537.4-377s21c1
Sequence:CCGGGATTTGGCCAATCGGGAATTTCTCGAGAAATTCCCGATTGGCCAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008537.4-411s21c1
Sequence:CCGGTGGCCATGACATCAACTATTTCTCGAGAAATAGTTGATGTCATGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008537.4-1450s21c1
Sequence:CCGGTGGTGAAGTGTATCCATTTATCTCGAGATAAATGGATACACTTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008537.4-770s21c1
Sequence:CCGGTCTATGCACTGCTGCTTAAAGCTCGAGCTTTAAGCAGCAGTGCATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008537.4-893s21c1
Sequence:CCGGCAGAATGGTGCCAGATCTTTGCTCGAGCAAAGATCTGGCACCATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008537
VALIDATED
AMACR MISSION shRNA Lentiviral Transduction Particles
alpha-methylacyl-CoA racemase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008537.3-410s1c1
Sequence:CCGGGCTGGCCATGACATCAACTATCTCGAGATAGTTGATGTCATGGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008537.3-2016s1c1
Sequence:CCGGCCGGAAGACTTCGTACTGAATCTCGAGATTCAGTACGAAGTCTTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008537.3-905s1c1
Sequence:CCGGCAGATCTTTGACGGGACAGATCTCGAGATCTGTCCCGTCAAAGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008537.3-2391s1c1
Sequence:CCGGCGATTCTGTTTGTCTTGACTTCTCGAGAAGTCAAGACAAACAGAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008537.4-377s21c1
Sequence:CCGGGATTTGGCCAATCGGGAATTTCTCGAGAAATTCCCGATTGGCCAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008537.4-411s21c1
Sequence:CCGGTGGCCATGACATCAACTATTTCTCGAGAAATAGTTGATGTCATGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008537.4-1450s21c1
Sequence:CCGGTGGTGAAGTGTATCCATTTATCTCGAGATAAATGGATACACTTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008537.4-770s21c1
Sequence:CCGGTCTATGCACTGCTGCTTAAAGCTCGAGCTTTAAGCAGCAGTGCATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008537.4-893s21c1
Sequence:CCGGCAGAATGGTGCCAGATCTTTGCTCGAGCAAAGATCTGGCACCATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)