EMAIL THIS PAGE TO A FRIEND

AMN

amnion associated transmembrane protein

48 Gene Product Result for
Synonyms: PRO1028 amnionless
UniProtKB ID: Q9BXJ7, Q6UX83
Gene ID:
Human(81693) Summary: The protein encoded by this gene is a type I transmembrane protein. It is thought to modulate bone morphogenetic protein (BMP) receptor function by serving as an accessory or coreceptor, and thus facilitates or hinders BMP binding. It is known that the mouse AMN gene is expressed in the extraembryonic visceral endoderm layer during gastrulation, but it is found to be mutated in amnionless mouse. The encoded protein has sequence similarity to short gastrulation (Sog) and procollagen IIA proteins in Drosophila. [provided by RefSeq, Jul 2008]
Mouse(93835) amnionless
Rat(314459) amnion associated transmembrane protein
Zebrafish(793454) amnion associated transmembrane protein
domestic cat(101084117) amnionless homolog (mouse)
dog(403434) amnionless homolog (mouse)
cow(767976) amnionless homolog (mouse)
fruit fly(32999) amnesiac
chicken(423472) amnionless homolog (mouse)
sheep(101122221) amnionless homolog (mouse)
domestic guinea pig(100721115) amnion associated transmembrane protein
naked mole-rat(101718043) amnion associated transmembrane protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030943 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033603 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033603 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033603 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150501 MISSION® esiRNA esiRNA human AMN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030943 Rosetta Predictions human pricing
NM_001108061 Rosetta Predictions rat pricing
NM_033603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048840 predicted 444
2 SASI_Hs01_00048843 predicted 859
3 SASI_Hs02_00358522 predicted 281
4 SASI_Hs01_00048846 predicted 792
5 SASI_Hs02_00358523 predicted 334
6 SASI_Hs02_00358524 predicted 456
7 SASI_Hs01_00048847 predicted 784
8 SASI_Hs01_00048848 predicted 205
9 SASI_Hs01_00048849 predicted 839
10 SASI_Hs02_00358525 predicted 275
11 SASI_Hs01_00048841 predicted 1518
12 SASI_Hs01_00048842 predicted 1520
13 SASI_Hs01_00048844 predicted 1451
14 SASI_Hs01_00048845 predicted 1513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234965 predicted 819
2 SASI_Rn02_00234966 predicted 487
3 SASI_Rn02_00234967 predicted 1334
4 SASI_Rn02_00234968 predicted 1111
5 SASI_Rn02_00234969 predicted 1498
6 SASI_Rn02_00234970 predicted 1112
7 SASI_Rn02_00234971 predicted 1458
8 SASI_Rn02_00234972 predicted 1522
9 SASI_Rn02_00234973 predicted 854
10 SASI_Rn02_00234974 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062363 predicted 766
2 SASI_Mm01_00062364 predicted 1380
3 SASI_Mm01_00062365 predicted 655
4 SASI_Mm02_00337464 predicted 1291
5 SASI_Mm01_00062366 predicted 793
6 SASI_Mm01_00062367 predicted 1041
7 SASI_Mm01_00062368 predicted 1327
8 SASI_Mm01_00062370 predicted 524
9 SASI_Mm01_00062371 predicted 540
10 SASI_Mm01_00062372 predicted 415
11 SASI_Mm01_00062369 predicted 1411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030943
AMN MISSION shRNA Bacterial Glycerol Stock
amnion associated transmembrane protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030943.1-1704s1c1
Sequence:CCGGGCGAAGTTGAACCCAGAACTACTCGAGTAGTTCTGGGTTCAACTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030943.1-1330s1c1
Sequence:CCGGCAGCCACAGTTACTTCGTCAACTCGAGTTGACGAAGTAACTGTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030943.1-323s1c1
Sequence:CCGGCCTGCCGTCTTCCGCGACTCTCTCGAGAGAGTCGCGGAAGACGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030943.1-188s1c1
Sequence:CCGGGTGTCAGTCCTGGTGCAAGAACTCGAGTTCTTGCACCAGGACTGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030943.3-454s21c1
Sequence:CCGGGACGTCTTCTTTCCGCCTAGTCTCGAGACTAGGCGGAAAGAAGACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030943.3-783s21c1
Sequence:CCGGTGACCTCTGTGGAGCCGTTGTCTCGAGACAACGGCTCCACAGAGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030943.3-119s21c1
Sequence:CCGGACTTCGACGTCGCAGCCAACTCTCGAGAGTTGGCTGCGACGTCGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030943.3-936s21c1
Sequence:CCGGTGAGGCCGATACGGAGATCCACTCGAGTGGATCTCCGTATCGGCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030943
AMN MISSION shRNA shRNA Plasmid DNA
amnion associated transmembrane protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030943.1-1704s1c1
Sequence:CCGGGCGAAGTTGAACCCAGAACTACTCGAGTAGTTCTGGGTTCAACTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030943.1-1330s1c1
Sequence:CCGGCAGCCACAGTTACTTCGTCAACTCGAGTTGACGAAGTAACTGTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030943.1-323s1c1
Sequence:CCGGCCTGCCGTCTTCCGCGACTCTCTCGAGAGAGTCGCGGAAGACGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030943.1-188s1c1
Sequence:CCGGGTGTCAGTCCTGGTGCAAGAACTCGAGTTCTTGCACCAGGACTGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030943.3-454s21c1
Sequence:CCGGGACGTCTTCTTTCCGCCTAGTCTCGAGACTAGGCGGAAAGAAGACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030943.3-783s21c1
Sequence:CCGGTGACCTCTGTGGAGCCGTTGTCTCGAGACAACGGCTCCACAGAGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030943.3-119s21c1
Sequence:CCGGACTTCGACGTCGCAGCCAACTCTCGAGAGTTGGCTGCGACGTCGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030943.3-936s21c1
Sequence:CCGGTGAGGCCGATACGGAGATCCACTCGAGTGGATCTCCGTATCGGCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030943
AMN MISSION shRNA Lentiviral Transduction Particles
amnion associated transmembrane protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030943.1-1704s1c1
Sequence:CCGGGCGAAGTTGAACCCAGAACTACTCGAGTAGTTCTGGGTTCAACTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030943.1-1330s1c1
Sequence:CCGGCAGCCACAGTTACTTCGTCAACTCGAGTTGACGAAGTAACTGTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030943.1-323s1c1
Sequence:CCGGCCTGCCGTCTTCCGCGACTCTCTCGAGAGAGTCGCGGAAGACGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030943.1-188s1c1
Sequence:CCGGGTGTCAGTCCTGGTGCAAGAACTCGAGTTCTTGCACCAGGACTGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030943.3-454s21c1
Sequence:CCGGGACGTCTTCTTTCCGCCTAGTCTCGAGACTAGGCGGAAAGAAGACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030943.3-783s21c1
Sequence:CCGGTGACCTCTGTGGAGCCGTTGTCTCGAGACAACGGCTCCACAGAGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030943.3-119s21c1
Sequence:CCGGACTTCGACGTCGCAGCCAACTCTCGAGAGTTGGCTGCGACGTCGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030943.3-936s21c1
Sequence:CCGGTGAGGCCGATACGGAGATCCACTCGAGTGGATCTCCGTATCGGCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033603
AMN MISSION shRNA Bacterial Glycerol Stock
amnion associated transmembrane protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033603.2-1483s1c1
Sequence:CCGGCCCAATAAAGAGTTGCTTGTTCTCGAGAACAAGCAACTCTTTATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033603.2-140s1c1
Sequence:CCGGCGCGGGAGATGCGGTTCAGTTCTCGAGAACTGAACCGCATCTCCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033603.2-1325s1c1
Sequence:CCGGTGATACCAAGTTCGGCTGCTTCTCGAGAAGCAGCCGAACTTGGTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033603.2-1341s1c1
Sequence:CCGGTGCTTCGTTAACCCACTCTTTCTCGAGAAAGAGTGGGTTAACGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033603.2-1226s1c1
Sequence:CCGGGCTGGGTTTCCGAAATCCGATCTCGAGATCGGATTTCGGAAACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033603
AMN MISSION shRNA shRNA Plasmid DNA
amnion associated transmembrane protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033603.2-1483s1c1
Sequence:CCGGCCCAATAAAGAGTTGCTTGTTCTCGAGAACAAGCAACTCTTTATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033603.2-140s1c1
Sequence:CCGGCGCGGGAGATGCGGTTCAGTTCTCGAGAACTGAACCGCATCTCCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033603.2-1325s1c1
Sequence:CCGGTGATACCAAGTTCGGCTGCTTCTCGAGAAGCAGCCGAACTTGGTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033603.2-1341s1c1
Sequence:CCGGTGCTTCGTTAACCCACTCTTTCTCGAGAAAGAGTGGGTTAACGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033603.2-1226s1c1
Sequence:CCGGGCTGGGTTTCCGAAATCCGATCTCGAGATCGGATTTCGGAAACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033603
AMN MISSION shRNA Lentiviral Transduction Particles
amnion associated transmembrane protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033603.2-1483s1c1
Sequence:CCGGCCCAATAAAGAGTTGCTTGTTCTCGAGAACAAGCAACTCTTTATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033603.2-140s1c1
Sequence:CCGGCGCGGGAGATGCGGTTCAGTTCTCGAGAACTGAACCGCATCTCCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033603.2-1325s1c1
Sequence:CCGGTGATACCAAGTTCGGCTGCTTCTCGAGAAGCAGCCGAACTTGGTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033603.2-1341s1c1
Sequence:CCGGTGCTTCGTTAACCCACTCTTTCTCGAGAAAGAGTGGGTTAACGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033603.2-1226s1c1
Sequence:CCGGGCTGGGTTTCCGAAATCCGATCTCGAGATCGGATTTCGGAAACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)