EMAIL THIS PAGE TO A FRIEND

AMZ1

archaelysin family metallopeptidase 1

60 Gene Product Result for
UniProtKB ID: Q400G9, Q8TF51
Gene ID:
Mouse(231842) archaelysin family metallopeptidase 1
Rat(304317) archaelysin family metallopeptidase 1
chicken(416474) archaelysin family metallopeptidase 1
cow(789913) archaelysin family metallopeptidase 1
Horse(100059978) archaelysin family metallopeptidase 1
domestic cat(101093066) archaelysin family metallopeptidase 1
dog(489888) archaelysin family metallopeptidase 1
sheep(101111338) archaelysin family metallopeptidase 1
naked mole-rat(101697790) archaelysin family metallopeptidase 1
domestic guinea pig(100726476) archaelysin family metallopeptidase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173405 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173405 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173405 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133463 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133463 Rosetta Predictions human pricing
NM_001047092 Rosetta Predictions rat pricing
XM_221964 Rosetta Predictions rat pricing
NM_173405 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363158 predicted 1302
2 SASI_Hs01_00045429 predicted 1287
3 SASI_Hs01_00045430 predicted 505
4 SASI_Hs01_00045431 predicted 638
5 SASI_Hs01_00045433 predicted 807
6 SASI_Hs01_00045434 predicted 686
7 SASI_Hs02_00363159 predicted 1275
8 SASI_Hs01_00045435 predicted 870
9 SASI_Hs02_00363160 predicted 1529
10 SASI_Hs01_00045437 predicted 939
11 SASI_Hs01_00045432 predicted 894
12 SASI_Hs01_00045436 predicted 1519
13 SASI_Hs01_00045438 predicted 1484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205854 predicted 281
2 SASI_Rn02_00205855 predicted 467
3 SASI_Rn02_00205856 predicted 563
4 SASI_Rn02_00205857 predicted 865
5 SASI_Rn02_00205858 predicted 879
6 SASI_Rn02_00205859 predicted 947
7 SASI_Rn02_00205860 predicted 975
8 SASI_Rn02_00205861 predicted 715
9 SASI_Rn02_00205862 predicted 601
10 SASI_Rn02_00205863 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00185722 predicted 306
2 SASI_Rn01_00185723 predicted 210
3 SASI_Rn01_00185724 predicted 289
4 SASI_Rn01_00185725 predicted 292
5 SASI_Rn01_00185726 predicted 280
6 SASI_Rn01_00185727 predicted 248
7 SASI_Rn01_00185728 predicted 239
8 SASI_Rn01_00185729 predicted 229
9 SASI_Rn01_00185730 predicted 220
10 SASI_Rn01_00185731 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135673 predicted 831
2 SASI_Mm02_00345262 predicted 813
3 SASI_Mm01_00135674 predicted 2260
4 SASI_Mm01_00135675 predicted 638
5 SASI_Mm01_00135676 predicted 1330
6 SASI_Mm01_00135677 predicted 2235
7 SASI_Mm01_00135678 predicted 798
8 SASI_Mm01_00135679 predicted 2236
9 SASI_Mm01_00135680 predicted 1008
10 SASI_Mm01_00135681 predicted 2255
11 SASI_Mm01_00135682 predicted 2148
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173405
AMZ1 MISSION shRNA Bacterial Glycerol Stock
archaelysin family metallopeptidase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173405.1-531s1c1
Sequence:CCGGCTGCTCATTCACTCAGCCTATCTCGAGATAGGCTGAGTGAATGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173405.1-533s1c1
Sequence:CCGGGCTCATTCACTCAGCCTATGACTCGAGTCATAGGCTGAGTGAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173405.1-2159s1c1
Sequence:CCGGGCTGTGTATGTCTGTTTCTATCTCGAGATAGAAACAGACATACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173405.1-1299s1c1
Sequence:CCGGGAGAGGTACAAGAGACTCCATCTCGAGATGGAGTCTCTTGTACCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173405.1-772s1c1
Sequence:CCGGCCTCCATTAACTGCTGCTCAACTCGAGTTGAGCAGCAGTTAATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173405
AMZ1 MISSION shRNA shRNA Plasmid DNA
archaelysin family metallopeptidase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173405.1-531s1c1
Sequence:CCGGCTGCTCATTCACTCAGCCTATCTCGAGATAGGCTGAGTGAATGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173405.1-533s1c1
Sequence:CCGGGCTCATTCACTCAGCCTATGACTCGAGTCATAGGCTGAGTGAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173405.1-2159s1c1
Sequence:CCGGGCTGTGTATGTCTGTTTCTATCTCGAGATAGAAACAGACATACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173405.1-1299s1c1
Sequence:CCGGGAGAGGTACAAGAGACTCCATCTCGAGATGGAGTCTCTTGTACCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173405.1-772s1c1
Sequence:CCGGCCTCCATTAACTGCTGCTCAACTCGAGTTGAGCAGCAGTTAATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173405
AMZ1 MISSION shRNA Lentiviral Transduction Particles
archaelysin family metallopeptidase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173405.1-531s1c1
Sequence:CCGGCTGCTCATTCACTCAGCCTATCTCGAGATAGGCTGAGTGAATGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173405.1-533s1c1
Sequence:CCGGGCTCATTCACTCAGCCTATGACTCGAGTCATAGGCTGAGTGAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173405.1-2159s1c1
Sequence:CCGGGCTGTGTATGTCTGTTTCTATCTCGAGATAGAAACAGACATACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173405.1-1299s1c1
Sequence:CCGGGAGAGGTACAAGAGACTCCATCTCGAGATGGAGTCTCTTGTACCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173405.1-772s1c1
Sequence:CCGGCCTCCATTAACTGCTGCTCAACTCGAGTTGAGCAGCAGTTAATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133463
AMZ1 MISSION shRNA Bacterial Glycerol Stock
archaelysin family metallopeptidase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133463.1-3406s1c1
Sequence:CCGGGCTCAGAAGTAGCATTAGGATCTCGAGATCCTAATGCTACTTCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133463.1-2996s1c1
Sequence:CCGGCTGCACTTTGAAGCTCCTTTACTCGAGTAAAGGAGCTTCAAAGTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133463.1-841s1c1
Sequence:CCGGCCTGTCCTTCTTGAAGAACAACTCGAGTTGTTCTTCAAGAAGGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133463.1-844s1c1
Sequence:CCGGGTCCTTCTTGAAGAACAACAACTCGAGTTGTTGTTCTTCAAGAAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133463.1-2955s1c1
Sequence:CCGGCGTTTGATCTGTCTCCCTTTACTCGAGTAAAGGGAGACAGATCAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133463.1-2453s1c1
Sequence:CCGGGCCTGCCCTTCAGTTATTTATCTCGAGATAAATAACTGAAGGGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133463.1-1932s21c1
Sequence:CCGGTGACCTGCCAGGGATAAAGAGCTCGAGCTCTTTATCCCTGGCAGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133463.1-1281s21c1
Sequence:CCGGTGGGTTTCAGGCTCATCGAGACTCGAGTCTCGATGAGCCTGAAACCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133463.1-1998s21c1
Sequence:CCGGTTGAGAGGCCAGGAGTTTGAGCTCGAGCTCAAACTCCTGGCCTCTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133463
AMZ1 MISSION shRNA shRNA Plasmid DNA
archaelysin family metallopeptidase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133463.1-3406s1c1
Sequence:CCGGGCTCAGAAGTAGCATTAGGATCTCGAGATCCTAATGCTACTTCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133463.1-2996s1c1
Sequence:CCGGCTGCACTTTGAAGCTCCTTTACTCGAGTAAAGGAGCTTCAAAGTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133463.1-841s1c1
Sequence:CCGGCCTGTCCTTCTTGAAGAACAACTCGAGTTGTTCTTCAAGAAGGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133463.1-844s1c1
Sequence:CCGGGTCCTTCTTGAAGAACAACAACTCGAGTTGTTGTTCTTCAAGAAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133463.1-2955s1c1
Sequence:CCGGCGTTTGATCTGTCTCCCTTTACTCGAGTAAAGGGAGACAGATCAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133463.1-2453s1c1
Sequence:CCGGGCCTGCCCTTCAGTTATTTATCTCGAGATAAATAACTGAAGGGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133463.1-1932s21c1
Sequence:CCGGTGACCTGCCAGGGATAAAGAGCTCGAGCTCTTTATCCCTGGCAGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133463.1-1281s21c1
Sequence:CCGGTGGGTTTCAGGCTCATCGAGACTCGAGTCTCGATGAGCCTGAAACCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133463.1-1998s21c1
Sequence:CCGGTTGAGAGGCCAGGAGTTTGAGCTCGAGCTCAAACTCCTGGCCTCTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133463
AMZ1 MISSION shRNA Lentiviral Transduction Particles
archaelysin family metallopeptidase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149779    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133463.1-3406s1c1
Sequence:CCGGGCTCAGAAGTAGCATTAGGATCTCGAGATCCTAATGCTACTTCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133463.1-2996s1c1
Sequence:CCGGCTGCACTTTGAAGCTCCTTTACTCGAGTAAAGGAGCTTCAAAGTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133463.1-841s1c1
Sequence:CCGGCCTGTCCTTCTTGAAGAACAACTCGAGTTGTTCTTCAAGAAGGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133463.1-844s1c1
Sequence:CCGGGTCCTTCTTGAAGAACAACAACTCGAGTTGTTGTTCTTCAAGAAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133463.1-2955s1c1
Sequence:CCGGCGTTTGATCTGTCTCCCTTTACTCGAGTAAAGGGAGACAGATCAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133463.1-2453s1c1
Sequence:CCGGGCCTGCCCTTCAGTTATTTATCTCGAGATAAATAACTGAAGGGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133463.1-1932s21c1
Sequence:CCGGTGACCTGCCAGGGATAAAGAGCTCGAGCTCTTTATCCCTGGCAGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133463.1-1281s21c1
Sequence:CCGGTGGGTTTCAGGCTCATCGAGACTCGAGTCTCGATGAGCCTGAAACCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133463.1-1998s21c1
Sequence:CCGGTTGAGAGGCCAGGAGTTTGAGCTCGAGCTCAAACTCCTGGCCTCTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)