EMAIL THIS PAGE TO A FRIEND

ANAPC7

anaphase promoting complex subunit 7

86 Gene Product Result for
Synonyms: APC7
UniProtKB ID: Q9UJX3, Q96AC4, Q96GF4, Q9BU24, Q9NT16
Gene ID:
Human(51434) Summary: This gene encodes a tetratricopeptide repeat containing component of the anaphase promoting complex/cyclosome (APC/C), a large E3 ubiquitin ligase that controls cell cycle progression by targeting a number of cell cycle regulators such as B-type cyclins for 26S proteasome-mediated degradation through ubiquitination. The encoded protein is required for proper protein ubiquitination function of APC/C and for the interaction of APC/C with certain transcription coactivators. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Mouse(56317) anaphase promoting complex subunit 7
Rat(304490) anaphase promoting complex subunit 7
naked mole-rat(101720262) anaphase promoting complex subunit 7
domestic guinea pig(100716878) anaphase promoting complex subunit 7
sheep(101104605) anaphase promoting complex subunit 7
Zebrafish(558402) anaphase promoting complex subunit 7
cow(535072) anaphase promoting complex subunit 7
dog(486264) anaphase promoting complex subunit 7
domestic cat(101098406) anaphase promoting complex subunit 7
chicken(416838) anaphase promoting complex subunit 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2900813 Anti-ANAPC7 / APC7 antibody produced in rabbit affinity isolated antibody human
western blot pricing
AV41605 Anti-ANAPC7 antibody produced in rabbit affinity isolated antibody guinea pig, rat, bovine, human, canine, mouse, horse, rabbit
immunohistochemistry, western blot pricing
SAB3500309 Anti-APC7 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016238 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016238 Rosetta Predictions human pricing
NM_001107142 Rosetta Predictions rat pricing
NM_019805 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167546 predicted 697
2 SASI_Hs01_00167547 predicted 1322
3 SASI_Hs01_00167548 predicted 486
4 SASI_Hs01_00167549 predicted 262
5 SASI_Hs01_00167551 predicted 711
6 SASI_Hs01_00167552 predicted 342
7 SASI_Hs01_00167553 predicted 893
8 SASI_Hs01_00167554 predicted 657
9 SASI_Hs01_00167555 predicted 1006
10 SASI_Hs02_00349110 predicted 1177
11 SASI_Hs01_00167550 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225915 predicted 797
2 SASI_Rn02_00225916 predicted 468
3 SASI_Rn02_00225917 predicted 575
4 SASI_Rn02_00225918 predicted 490
5 SASI_Rn02_00225919 predicted 411
6 SASI_Rn02_00225920 predicted 1283
7 SASI_Rn02_00225921 predicted 1762
8 SASI_Rn02_00225922 predicted 1040
9 SASI_Rn02_00225923 predicted 839
10 SASI_Rn02_00225924 predicted 1416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325058 predicted 612
2 SASI_Mm02_00325059 predicted 1471
3 SASI_Mm02_00325060 predicted 283
4 SASI_Mm02_00325061 predicted 1235
5 SASI_Mm02_00325062 predicted 747
6 SASI_Mm02_00325063 predicted 644
7 SASI_Mm02_00325064 predicted 1828
8 SASI_Mm02_00325065 predicted 314
9 SASI_Mm02_00325066 predicted 226
10 SASI_Mm02_00325067 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019805
ANAPC7 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019805.4-735s21c1
Sequence:CCGGTGGCTGTCCGTGTGGATTAAACTCGAGTTTAATCCACACGGACAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019805.4-2248s21c1
Sequence:CCGGAGGACAGGCTCACCTAATAAACTCGAGTTTATTAGGTGAGCCTGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019805.4-284s21c1
Sequence:CCGGAGACTCTCTGTTTCACGATAACTCGAGTTATCGTGAAACAGAGAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019805.2-394s1c1
Sequence:CCGGCCATCTGAAATTGAAGTGAAACTCGAGTTTCACTTCAATTTCAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019805.2-322s1c1
Sequence:CCGGGCCTTAAGTAAGACTTCCAAACTCGAGTTTGGAAGTCTTACTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019805.2-1868s1c1
Sequence:CCGGCCTGCCTGTTTCCAAGTAGTACTCGAGTACTACTTGGAAACAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019805.2-174s1c1
Sequence:CCGGGCTGCTCACCATGAGTAACAACTCGAGTTGTTACTCATGGTGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019805.2-1227s1c1
Sequence:CCGGCGAAGGTCTCATAGAGTGTTACTCGAGTAACACTCTATGAGACCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019805
ANAPC7 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019805.4-735s21c1
Sequence:CCGGTGGCTGTCCGTGTGGATTAAACTCGAGTTTAATCCACACGGACAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019805.4-2248s21c1
Sequence:CCGGAGGACAGGCTCACCTAATAAACTCGAGTTTATTAGGTGAGCCTGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019805.4-284s21c1
Sequence:CCGGAGACTCTCTGTTTCACGATAACTCGAGTTATCGTGAAACAGAGAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019805.2-394s1c1
Sequence:CCGGCCATCTGAAATTGAAGTGAAACTCGAGTTTCACTTCAATTTCAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019805.2-322s1c1
Sequence:CCGGGCCTTAAGTAAGACTTCCAAACTCGAGTTTGGAAGTCTTACTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019805.2-1868s1c1
Sequence:CCGGCCTGCCTGTTTCCAAGTAGTACTCGAGTACTACTTGGAAACAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019805.2-174s1c1
Sequence:CCGGGCTGCTCACCATGAGTAACAACTCGAGTTGTTACTCATGGTGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019805.2-1227s1c1
Sequence:CCGGCGAAGGTCTCATAGAGTGTTACTCGAGTAACACTCTATGAGACCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019805
ANAPC7 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019805.4-735s21c1
Sequence:CCGGTGGCTGTCCGTGTGGATTAAACTCGAGTTTAATCCACACGGACAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019805.4-2248s21c1
Sequence:CCGGAGGACAGGCTCACCTAATAAACTCGAGTTTATTAGGTGAGCCTGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019805.4-284s21c1
Sequence:CCGGAGACTCTCTGTTTCACGATAACTCGAGTTATCGTGAAACAGAGAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019805.2-394s1c1
Sequence:CCGGCCATCTGAAATTGAAGTGAAACTCGAGTTTCACTTCAATTTCAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019805.2-322s1c1
Sequence:CCGGGCCTTAAGTAAGACTTCCAAACTCGAGTTTGGAAGTCTTACTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019805.2-1868s1c1
Sequence:CCGGCCTGCCTGTTTCCAAGTAGTACTCGAGTACTACTTGGAAACAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019805.2-174s1c1
Sequence:CCGGGCTGCTCACCATGAGTAACAACTCGAGTTGTTACTCATGGTGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019805.2-1227s1c1
Sequence:CCGGCGAAGGTCTCATAGAGTGTTACTCGAGTAACACTCTATGAGACCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016238
VALIDATED
ANAPC7 MISSION shRNA Bacterial Glycerol Stock
anaphase promoting complex subunit 7
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-1283s21c1
Sequence:CCGGGTAATGGCTAACAACGTTTACCTCGAGGTAAACGTTGTTAGCCATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-890s21c1
Sequence:CCGGGCACAGATGTTGGATCCTTATCTCGAGATAAGGATCCAACATCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-317s21c1
Sequence:CCGGCAGAAGAAAGCGCTAAGTAAACTCGAGTTTACTTAGCGCTTTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-1583s21c1
Sequence:CCGGGCAATGGACCAGTATAGTATACTCGAGTATACTATACTGGTCCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-1118s21c1
Sequence:CCGGGTTCAAGCTCTGCTACTTAAGCTCGAGCTTAAGTAGCAGAGCTTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-1250s21c1
Sequence:CCGGTACTTAGCCTCCAACAGTATTCTCGAGAATACTGTTGGAGGCTAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016238.1-71s1c1
Sequence:CCGGGCTTGTTACTTACAATGAGTACTCGAGTACTCATTGTAAGTAACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016238.1-699s1c1
Sequence:CCGGGCGAGATAACGTGGACCTATTCTCGAGAATAGGTCCACGTTATCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016238.1-1108s1c1
Sequence:CCGGCCTTGTCGCTTAGATTGTTATCTCGAGATAACAATCTAAGCGACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016238.1-178s1c1
Sequence:CCGGCGGAATGCTGTGAGTAAGTATCTCGAGATACTTACTCACAGCATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016238.1-1447s1c1
Sequence:CCGGGATTTCCTTGTAGCTGTCAATCTCGAGATTGACAGCTACAAGGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016238
VALIDATED
ANAPC7 MISSION shRNA shRNA Plasmid DNA
anaphase promoting complex subunit 7
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-1283s21c1
Sequence:CCGGGTAATGGCTAACAACGTTTACCTCGAGGTAAACGTTGTTAGCCATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-890s21c1
Sequence:CCGGGCACAGATGTTGGATCCTTATCTCGAGATAAGGATCCAACATCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-317s21c1
Sequence:CCGGCAGAAGAAAGCGCTAAGTAAACTCGAGTTTACTTAGCGCTTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-1583s21c1
Sequence:CCGGGCAATGGACCAGTATAGTATACTCGAGTATACTATACTGGTCCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-1118s21c1
Sequence:CCGGGTTCAAGCTCTGCTACTTAAGCTCGAGCTTAAGTAGCAGAGCTTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-1250s21c1
Sequence:CCGGTACTTAGCCTCCAACAGTATTCTCGAGAATACTGTTGGAGGCTAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016238.1-71s1c1
Sequence:CCGGGCTTGTTACTTACAATGAGTACTCGAGTACTCATTGTAAGTAACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016238.1-699s1c1
Sequence:CCGGGCGAGATAACGTGGACCTATTCTCGAGAATAGGTCCACGTTATCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016238.1-1108s1c1
Sequence:CCGGCCTTGTCGCTTAGATTGTTATCTCGAGATAACAATCTAAGCGACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016238.1-178s1c1
Sequence:CCGGCGGAATGCTGTGAGTAAGTATCTCGAGATACTTACTCACAGCATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016238.1-1447s1c1
Sequence:CCGGGATTTCCTTGTAGCTGTCAATCTCGAGATTGACAGCTACAAGGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016238
VALIDATED
ANAPC7 MISSION shRNA Lentiviral Transduction Particles
anaphase promoting complex subunit 7
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-1283s21c1
Sequence:CCGGGTAATGGCTAACAACGTTTACCTCGAGGTAAACGTTGTTAGCCATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-890s21c1
Sequence:CCGGGCACAGATGTTGGATCCTTATCTCGAGATAAGGATCCAACATCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-317s21c1
Sequence:CCGGCAGAAGAAAGCGCTAAGTAAACTCGAGTTTACTTAGCGCTTTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-1583s21c1
Sequence:CCGGGCAATGGACCAGTATAGTATACTCGAGTATACTATACTGGTCCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-1118s21c1
Sequence:CCGGGTTCAAGCTCTGCTACTTAAGCTCGAGCTTAAGTAGCAGAGCTTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016238.2-1250s21c1
Sequence:CCGGTACTTAGCCTCCAACAGTATTCTCGAGAATACTGTTGGAGGCTAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016238.1-71s1c1
Sequence:CCGGGCTTGTTACTTACAATGAGTACTCGAGTACTCATTGTAAGTAACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016238.1-699s1c1
Sequence:CCGGGCGAGATAACGTGGACCTATTCTCGAGAATAGGTCCACGTTATCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016238.1-1108s1c1
Sequence:CCGGCCTTGTCGCTTAGATTGTTATCTCGAGATAACAATCTAAGCGACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016238.1-178s1c1
Sequence:CCGGCGGAATGCTGTGAGTAAGTATCTCGAGATACTTACTCACAGCATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016238.1-1447s1c1
Sequence:CCGGGATTTCCTTGTAGCTGTCAATCTCGAGATTGACAGCTACAAGGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)