EMAIL THIS PAGE TO A FRIEND

ANGEL2

angel homolog 2 (Drosophila)

49 Gene Product Result for
Synonyms: KIAA0759L
UniProtKB ID: Q5VTE6, B7Z2U4, D3DTA3, Q86X13, Q8NHH3
Gene ID:
Mouse(52477) angel homolog 2 (Drosophila)
Rat(305035) angel homolog 2 (Drosophila)
sheep(101113611) angel homolog 2 (Drosophila)
domestic guinea pig(100714231) angel homolog 2 (Drosophila)
naked mole-rat(101716063) angel homolog 2 (Drosophila)
Zebrafish(562704) angel homolog 2 (Drosophila)
dog(490287) angel homolog 2 (Drosophila)
chicken(421363) angel homolog 2 (Drosophila)
cow(540507) angel homolog 2 (Drosophila)
Horse(100050459) angel homolog 2 (Drosophila)
domestic cat(101097864) angel homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144567 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144567 Rosetta Predictions human pricing
NM_021421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061200 predicted 627
2 SASI_Hs01_00061201 predicted 1186
3 SASI_Hs01_00061202 predicted 908
4 SASI_Hs02_00364336 predicted 1052
5 SASI_Hs01_00061203 predicted 731
6 SASI_Hs01_00061204 predicted 1002
7 SASI_Hs01_00061205 predicted 502
8 SASI_Hs01_00061206 predicted 251
9 SASI_Hs01_00061207 predicted 977
10 SASI_Hs01_00061208 predicted 1370
11 SASI_Hs01_00061209 predicted 1702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195614 predicted 849
2 SASI_Mm01_00195615 predicted 1466
3 SASI_Mm01_00195616 predicted 1067
4 SASI_Mm01_00195617 predicted 1221
5 SASI_Mm01_00195618 predicted 711
6 SASI_Mm01_00195619 predicted 965
7 SASI_Mm01_00195620 predicted 666
8 SASI_Mm01_00195621 predicted 494
9 SASI_Mm01_00195622 predicted 551
10 SASI_Mm01_00195623 predicted 1349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144567
VALIDATED
ANGEL2 MISSION shRNA Bacterial Glycerol Stock
angel homolog 2 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_144567.3-292s1c1
Sequence:CCGGGCTGGAACAGACATATTTCTACTCGAGTAGAAATATGTCTGTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_144567.3-3875s1c1
Sequence:CCGGGCAGGATATTATGTGCCCTAACTCGAGTTAGGGCACATAATATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144567.3-731s1c1
Sequence:CCGGGCCAGTATTACACTGGAGTTTCTCGAGAAACTCCAGTGTAATACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144567.3-977s1c1
Sequence:CCGGCCGCCCTGATATTTCTCTGTTCTCGAGAACAGAGAAATATCAGGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144567.3-1070s1c1
Sequence:CCGGCGTAGCAAATACGCATCTGTTCTCGAGAACAGATGCGTATTTGCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144567.3-356s21c1
Sequence:CCGGATACTTCAGTAGTAGGCATTTCTCGAGAAATGCCTACTACTGAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144567.3-1219s21c1
Sequence:CCGGTTCCTGGTTCTCCACTATATACTCGAGTATATAGTGGAGAACCAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144567.3-3878s21c1
Sequence:CCGGGGATATTATGTGCCCTAATTACTCGAGTAATTAGGGCACATAATATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144567.3-1578s21c1
Sequence:CCGGGCCATAACTGTGGATTATATTCTCGAGAATATAATCCACAGTTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144567.3-1096s21c1
Sequence:CCGGATCCAAGGCGAGGTGATATTACTCGAGTAATATCACCTCGCCTTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144567
VALIDATED
ANGEL2 MISSION shRNA shRNA Plasmid DNA
angel homolog 2 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_144567.3-292s1c1
Sequence:CCGGGCTGGAACAGACATATTTCTACTCGAGTAGAAATATGTCTGTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_144567.3-3875s1c1
Sequence:CCGGGCAGGATATTATGTGCCCTAACTCGAGTTAGGGCACATAATATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144567.3-731s1c1
Sequence:CCGGGCCAGTATTACACTGGAGTTTCTCGAGAAACTCCAGTGTAATACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144567.3-977s1c1
Sequence:CCGGCCGCCCTGATATTTCTCTGTTCTCGAGAACAGAGAAATATCAGGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144567.3-1070s1c1
Sequence:CCGGCGTAGCAAATACGCATCTGTTCTCGAGAACAGATGCGTATTTGCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144567.3-356s21c1
Sequence:CCGGATACTTCAGTAGTAGGCATTTCTCGAGAAATGCCTACTACTGAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144567.3-1219s21c1
Sequence:CCGGTTCCTGGTTCTCCACTATATACTCGAGTATATAGTGGAGAACCAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144567.3-3878s21c1
Sequence:CCGGGGATATTATGTGCCCTAATTACTCGAGTAATTAGGGCACATAATATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144567.3-1578s21c1
Sequence:CCGGGCCATAACTGTGGATTATATTCTCGAGAATATAATCCACAGTTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144567.3-1096s21c1
Sequence:CCGGATCCAAGGCGAGGTGATATTACTCGAGTAATATCACCTCGCCTTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144567
VALIDATED
ANGEL2 MISSION shRNA Lentiviral Transduction Particles
angel homolog 2 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_144567.3-292s1c1
Sequence:CCGGGCTGGAACAGACATATTTCTACTCGAGTAGAAATATGTCTGTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108090    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_144567.3-3875s1c1
Sequence:CCGGGCAGGATATTATGTGCCCTAACTCGAGTTAGGGCACATAATATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144567.3-731s1c1
Sequence:CCGGGCCAGTATTACACTGGAGTTTCTCGAGAAACTCCAGTGTAATACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144567.3-977s1c1
Sequence:CCGGCCGCCCTGATATTTCTCTGTTCTCGAGAACAGAGAAATATCAGGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144567.3-1070s1c1
Sequence:CCGGCGTAGCAAATACGCATCTGTTCTCGAGAACAGATGCGTATTTGCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144567.3-356s21c1
Sequence:CCGGATACTTCAGTAGTAGGCATTTCTCGAGAAATGCCTACTACTGAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144567.3-1219s21c1
Sequence:CCGGTTCCTGGTTCTCCACTATATACTCGAGTATATAGTGGAGAACCAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144567.3-3878s21c1
Sequence:CCGGGGATATTATGTGCCCTAATTACTCGAGTAATTAGGGCACATAATATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144567.3-1578s21c1
Sequence:CCGGGCCATAACTGTGGATTATATTCTCGAGAATATAATCCACAGTTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_144567.3-1096s21c1
Sequence:CCGGATCCAAGGCGAGGTGATATTACTCGAGTAATATCACCTCGCCTTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021421
VALIDATED
ANGEL2 MISSION shRNA Bacterial Glycerol Stock
angel homolog 2 (Drosophila)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021421.2-240s1c1
Sequence:CCGGGTCCAGTGTTACACTGGAGTTCTCGAGAACTCCAGTGTAACACTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198429    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021421.2-2116s1c1
Sequence:CCGGGCTACATGAAACCCTATCTTACTCGAGTAAGATAGGGTTTCATGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021421.2-656s1c1
Sequence:CCGGGAGATTGCCAATGTGACCCATCTCGAGATGGGTCACATTGGCAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021421.2-305s1c1
Sequence:CCGGGATGTGCTTTGTCTACAGGAACTCGAGTTCCTGTAGACAAAGCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021421.2-332s1c1
Sequence:CCGGGAAGATCATTATGGGACAGAACTCGAGTTCTGTCCCATAATGATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021421.2-2303s1c1
Sequence:CCGGGCTGACTAGAACTACACACAACTCGAGTTGTGTGTAGTTCTAGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021421.2-2238s1c1
Sequence:CCGGGCATCCACAAACACCCTTAATCTCGAGATTAAGGGTGTTTGTGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-1915s21c1
Sequence:CCGGGATTGGAAGAAACAAATTTACCTCGAGGTAAATTTGTTTCTTCCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-417s21c1
Sequence:CCGGACGCAGTTTCAGTACTATAATCTCGAGATTATAGTACTGAAACTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-631s21c1
Sequence:CCGGAGGACCGTGAAGATAAGTTTGCTCGAGCAAACTTATCTTCACGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-1578s21c1
Sequence:CCGGGCCATAACTGTTGATTATATTCTCGAGAATATAATCAACAGTTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-934s21c1
Sequence:CCGGATTCCAGGTTCTCGCTCTTATCTCGAGATAAGAGCGAGAACCTGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-857s21c1
Sequence:CCGGGGAATCACTGGGTTATCATTGCTCGAGCAATGATAACCCAGTGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021421
VALIDATED
ANGEL2 MISSION shRNA shRNA Plasmid DNA
angel homolog 2 (Drosophila)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021421.2-240s1c1
Sequence:CCGGGTCCAGTGTTACACTGGAGTTCTCGAGAACTCCAGTGTAACACTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198429    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021421.2-2116s1c1
Sequence:CCGGGCTACATGAAACCCTATCTTACTCGAGTAAGATAGGGTTTCATGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021421.2-656s1c1
Sequence:CCGGGAGATTGCCAATGTGACCCATCTCGAGATGGGTCACATTGGCAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021421.2-305s1c1
Sequence:CCGGGATGTGCTTTGTCTACAGGAACTCGAGTTCCTGTAGACAAAGCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021421.2-332s1c1
Sequence:CCGGGAAGATCATTATGGGACAGAACTCGAGTTCTGTCCCATAATGATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021421.2-2303s1c1
Sequence:CCGGGCTGACTAGAACTACACACAACTCGAGTTGTGTGTAGTTCTAGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021421.2-2238s1c1
Sequence:CCGGGCATCCACAAACACCCTTAATCTCGAGATTAAGGGTGTTTGTGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-1915s21c1
Sequence:CCGGGATTGGAAGAAACAAATTTACCTCGAGGTAAATTTGTTTCTTCCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-417s21c1
Sequence:CCGGACGCAGTTTCAGTACTATAATCTCGAGATTATAGTACTGAAACTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-631s21c1
Sequence:CCGGAGGACCGTGAAGATAAGTTTGCTCGAGCAAACTTATCTTCACGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-1578s21c1
Sequence:CCGGGCCATAACTGTTGATTATATTCTCGAGAATATAATCAACAGTTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-934s21c1
Sequence:CCGGATTCCAGGTTCTCGCTCTTATCTCGAGATAAGAGCGAGAACCTGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-857s21c1
Sequence:CCGGGGAATCACTGGGTTATCATTGCTCGAGCAATGATAACCCAGTGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021421
VALIDATED
ANGEL2 MISSION shRNA Lentiviral Transduction Particles
angel homolog 2 (Drosophila)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021421.2-240s1c1
Sequence:CCGGGTCCAGTGTTACACTGGAGTTCTCGAGAACTCCAGTGTAACACTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198429    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021421.2-2116s1c1
Sequence:CCGGGCTACATGAAACCCTATCTTACTCGAGTAAGATAGGGTTTCATGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021421.2-656s1c1
Sequence:CCGGGAGATTGCCAATGTGACCCATCTCGAGATGGGTCACATTGGCAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021421.2-305s1c1
Sequence:CCGGGATGTGCTTTGTCTACAGGAACTCGAGTTCCTGTAGACAAAGCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021421.2-332s1c1
Sequence:CCGGGAAGATCATTATGGGACAGAACTCGAGTTCTGTCCCATAATGATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021421.2-2303s1c1
Sequence:CCGGGCTGACTAGAACTACACACAACTCGAGTTGTGTGTAGTTCTAGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021421.2-2238s1c1
Sequence:CCGGGCATCCACAAACACCCTTAATCTCGAGATTAAGGGTGTTTGTGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-1915s21c1
Sequence:CCGGGATTGGAAGAAACAAATTTACCTCGAGGTAAATTTGTTTCTTCCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-417s21c1
Sequence:CCGGACGCAGTTTCAGTACTATAATCTCGAGATTATAGTACTGAAACTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-631s21c1
Sequence:CCGGAGGACCGTGAAGATAAGTTTGCTCGAGCAAACTTATCTTCACGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-1578s21c1
Sequence:CCGGGCCATAACTGTTGATTATATTCTCGAGAATATAATCAACAGTTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-934s21c1
Sequence:CCGGATTCCAGGTTCTCGCTCTTATCTCGAGATAAGAGCGAGAACCTGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021421.3-857s21c1
Sequence:CCGGGGAATCACTGGGTTATCATTGCTCGAGCAATGATAACCCAGTGATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)