EMAIL THIS PAGE TO A FRIEND

ANGPTL5

angiopoietin-like 5

30 Gene Product Result for
UniProtKB ID: Q86XS5, A8K658, Q86VR9
Gene ID:
Zebrafish(566212) angiopoietin-like 5
cow(514285) angiopoietin-like 5
Horse(100068749) angiopoietin-like 5
domestic cat(101101159) angiopoietin-like 5
dog(611905) angiopoietin-like 5
chicken(772036) angiopoietin-like 5
sheep(101120690) angiopoietin-like 5
domestic guinea pig(100726025) angiopoietin-like 5
naked mole-rat(101721493) angiopoietin-like 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178127 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138751 MISSION® esiRNA esiRNA human ANGPTL5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178127 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188112 predicted 886
2 SASI_Hs01_00188113 predicted 1057
3 SASI_Hs02_00369536 predicted 1242
4 SASI_Hs01_00188114 predicted 1696
5 SASI_Hs01_00188115 predicted 1130
6 SASI_Hs01_00188116 predicted 1042
7 SASI_Hs01_00188117 predicted 1776
8 SASI_Hs01_00188118 predicted 940
9 SASI_Hs01_00188119 predicted 908
10 SASI_Hs02_00369537 predicted 1827
11 SASI_Hs01_00188111 predicted 1841
12 SASI_Hs01_00188120 predicted 916
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178127
ANGPTL5 MISSION shRNA Bacterial Glycerol Stock
angiopoietin-like 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178127.2-2007s1c1
Sequence:CCGGGAACTACAACTTGTCTTCCTACTCGAGTAGGAAGACAAGTTGTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167434    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178127.2-1998s1c1
Sequence:CCGGGTTTCAAGTGAACTACAACTTCTCGAGAAGTTGTAGTTCACTTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178127.2-1617s1c1
Sequence:CCGGCTAGCAAATCTAAATGGCATTCTCGAGAATGCCATTTAGATTTGCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178127.2-1087s1c1
Sequence:CCGGCACCGAGTGGTTTATACATAACTCGAGTTATGTATAAACCACTCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178127.2-911s1c1
Sequence:CCGGGCAACAAGCTTCCTTGGATTACTCGAGTAATCCAAGGAAGCTTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178127.2-1608s1c1
Sequence:CCGGGAGTGTGGTCTAGCAAATCTACTCGAGTAGATTTGCTAGACCACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178127.4-711s21c1
Sequence:CCGGATTGTAGAAGATGGATCTAATCTCGAGATTAGATCCATCTTCTACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178127.4-689s21c1
Sequence:CCGGTACGGACTCTTCAGTAGTTAACTCGAGTTAACTACTGAAGAGTCCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178127.4-1036s21c1
Sequence:CCGGGTTTAGATTGCACTGATATTACTCGAGTAATATCAGTGCAATCTAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178127
ANGPTL5 MISSION shRNA shRNA Plasmid DNA
angiopoietin-like 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178127.2-2007s1c1
Sequence:CCGGGAACTACAACTTGTCTTCCTACTCGAGTAGGAAGACAAGTTGTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167434    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178127.2-1998s1c1
Sequence:CCGGGTTTCAAGTGAACTACAACTTCTCGAGAAGTTGTAGTTCACTTGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178127.2-1617s1c1
Sequence:CCGGCTAGCAAATCTAAATGGCATTCTCGAGAATGCCATTTAGATTTGCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178127.2-1087s1c1
Sequence:CCGGCACCGAGTGGTTTATACATAACTCGAGTTATGTATAAACCACTCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178127.2-911s1c1
Sequence:CCGGGCAACAAGCTTCCTTGGATTACTCGAGTAATCCAAGGAAGCTTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178127.2-1608s1c1
Sequence:CCGGGAGTGTGGTCTAGCAAATCTACTCGAGTAGATTTGCTAGACCACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178127.4-711s21c1
Sequence:CCGGATTGTAGAAGATGGATCTAATCTCGAGATTAGATCCATCTTCTACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178127.4-689s21c1
Sequence:CCGGTACGGACTCTTCAGTAGTTAACTCGAGTTAACTACTGAAGAGTCCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178127.4-1036s21c1
Sequence:CCGGGTTTAGATTGCACTGATATTACTCGAGTAATATCAGTGCAATCTAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178127
ANGPTL5 MISSION shRNA Lentiviral Transduction Particles
angiopoietin-like 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178127.2-2007s1c1
Sequence:CCGGGAACTACAACTTGTCTTCCTACTCGAGTAGGAAGACAAGTTGTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167434    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178127.2-1998s1c1
Sequence:CCGGGTTTCAAGTGAACTACAACTTCTCGAGAAGTTGTAGTTCACTTGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178127.2-1617s1c1
Sequence:CCGGCTAGCAAATCTAAATGGCATTCTCGAGAATGCCATTTAGATTTGCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178127.2-1087s1c1
Sequence:CCGGCACCGAGTGGTTTATACATAACTCGAGTTATGTATAAACCACTCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178127.2-911s1c1
Sequence:CCGGGCAACAAGCTTCCTTGGATTACTCGAGTAATCCAAGGAAGCTTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178127.2-1608s1c1
Sequence:CCGGGAGTGTGGTCTAGCAAATCTACTCGAGTAGATTTGCTAGACCACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178127.4-711s21c1
Sequence:CCGGATTGTAGAAGATGGATCTAATCTCGAGATTAGATCCATCTTCTACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178127.4-689s21c1
Sequence:CCGGTACGGACTCTTCAGTAGTTAACTCGAGTTAACTACTGAAGAGTCCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178127.4-1036s21c1
Sequence:CCGGGTTTAGATTGCACTGATATTACTCGAGTAATATCAGTGCAATCTAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)