EMAIL THIS PAGE TO A FRIEND

ANKRD11

ankyrin repeat domain 11

131 Gene Product Result for
Synonyms: ANCO-1 ANCO1 LZ16 T13
UniProtKB ID: Q6UB99, Q6NTG1, Q6QMF8
Gene ID:
Human(29123) Summary: This locus encodes an ankryin repeat domain-containing protein. The encoded protein inhibits ligand-dependent activation of transcription. Mutations in this gene have been associated with KBG syndrome, which is characterized by macrodontia, distinctive craniofacial features, short stature, skeletal anomalies, global developmental delay, seizures and intellectual disability. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2 and X. [provided by RefSeq, Jan 2012]
Mouse(77087) ankyrin repeat domain 11
Rat(365023) ankyrin repeat domain 11
Zebrafish(327352) ankyrin repeat domain 11
dog(489658) ankyrin repeat domain 11
domestic cat(101100431) ankyrin repeat domain 11
cow(532856) ankyrin repeat domain 11
Horse(100050107) ankyrin repeat domain 11
chicken(415845) ankyrin repeat domain 11
sheep(101110169) ankyrin repeat domain 11
naked mole-rat(101705112) ankyrin repeat domain 11
domestic guinea pig(100727156) ankyrin repeat domain 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013275 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081379 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081379 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081379 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013275 Rosetta Predictions human pricing
NM_001108900 Rosetta Predictions rat pricing
NM_001081379 Rosetta Predictions mouse pricing
XM_134514 Rosetta Predictions mouse pricing
XM_902605 Rosetta Predictions mouse pricing
XM_902607 Rosetta Predictions mouse pricing
XM_902609 Rosetta Predictions mouse pricing
XM_902611 Rosetta Predictions mouse pricing
XM_902618 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081869 predicted 4554
2 SASI_Hs01_00081870 predicted 883
3 SASI_Hs01_00081871 predicted 5757
4 SASI_Hs01_00081872 predicted 7814
5 SASI_Hs01_00081873 predicted 4329
6 SASI_Hs01_00081874 predicted 1400
7 SASI_Hs02_00344518 predicted 4222
8 SASI_Hs01_00081875 predicted 1150
9 SASI_Hs01_00081876 predicted 7715
10 SASI_Hs01_00081877 predicted 8197
11 SASI_Hs01_00081878 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243195 predicted 2658
2 SASI_Rn02_00243196 predicted 2192
3 SASI_Rn02_00243197 predicted 2145
4 SASI_Rn02_00243198 predicted 2812
5 SASI_Rn02_00243199 predicted 2007
6 SASI_Rn02_00243200 predicted 2079
7 SASI_Rn02_00243201 predicted 2492
8 SASI_Rn02_00243202 predicted 3176
9 SASI_Rn02_00243203 predicted 3472
10 SASI_Rn02_00243204 predicted 3240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297841 predicted 7091
2 SASI_Mm02_00297842 predicted 5776
3 SASI_Mm02_00297843 predicted 4556
4 SASI_Mm02_00297844 predicted 7161
5 SASI_Mm02_00297845 predicted 981
6 SASI_Mm02_00297846 predicted 1090
7 SASI_Mm02_00297847 predicted 5659
8 SASI_Mm02_00297848 predicted 5028
9 SASI_Mm02_00297849 predicted 264
10 SASI_Mm02_00297850 predicted 7478
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_134514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244096 predicted 7301
2 SASI_Mm01_00244097 predicted 3144
3 SASI_Mm01_00244098 predicted 5982
4 SASI_Mm01_00244099 predicted 7363
5 SASI_Mm01_00244100 predicted 1182
6 SASI_Mm01_00244101 predicted 1293
7 SASI_Mm01_00244102 predicted 5857
8 SASI_Mm01_00244103 predicted 5235
9 SASI_Mm01_00244104 predicted 528
10 SASI_Mm01_00244105 predicted 7684
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278931 predicted 13845
2 SASI_Mm01_00278932 predicted 12623
3 SASI_Mm01_00278933 predicted 15232
4 SASI_Mm01_00278934 predicted 9043
5 SASI_Mm01_00278935 predicted 9155
6 SASI_Mm01_00278936 predicted 13724
7 SASI_Mm01_00278937 predicted 13086
8 SASI_Mm01_00278938 predicted 11383
9 SASI_Mm01_00278939 predicted 15548
10 SASI_Mm01_00278940 predicted 9024
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264214 predicted 7945
2 SASI_Mm01_00264215 predicted 3790
3 SASI_Mm01_00264216 predicted 6613
4 SASI_Mm01_00264217 predicted 8005
5 SASI_Mm01_00264218 predicted 1827
6 SASI_Mm01_00264219 predicted 1941
7 SASI_Mm01_00264220 predicted 6503
8 SASI_Mm01_00264221 predicted 5864
9 SASI_Mm01_00264222 predicted 8661
10 SASI_Mm01_00264223 predicted 8328
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202109 predicted 7474
2 SASI_Mm01_00202110 predicted 6486
3 SASI_Mm01_00202111 predicted 2334
4 SASI_Mm01_00202112 predicted 5173
5 SASI_Mm01_00202113 predicted 3946
6 SASI_Mm01_00202114 predicted 6555
7 SASI_Mm01_00202115 predicted 5047
8 SASI_Mm01_00202116 predicted 4424
9 SASI_Mm01_00202117 predicted 7212
10 SASI_Mm01_00202118 predicted 6872
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209262 predicted 1163
2 SASI_Mm01_00209263 predicted 980
3 SASI_Mm01_00209264 predicted 1167
4 SASI_Mm01_00209265 predicted 1288
5 SASI_Mm01_00209266 predicted 1359
6 SASI_Mm01_00209267 predicted 1300
7 SASI_Mm01_00209268 predicted 1531
8 SASI_Mm01_00209269 predicted 1126
9 SASI_Mm01_00209270 predicted 815
10 SASI_Mm01_00209271 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234334 predicted 2951
2 SASI_Mm01_00234335 predicted 5776
3 SASI_Mm01_00234336 predicted 4563
4 SASI_Mm01_00234337 predicted 7166
5 SASI_Mm01_00234338 predicted 986
6 SASI_Mm01_00234339 predicted 1100
7 SASI_Mm01_00234340 predicted 5661
8 SASI_Mm01_00234341 predicted 5027
9 SASI_Mm01_00234342 predicted 264
10 SASI_Mm01_00234343 predicted 7480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013275
VALIDATED
ANKRD11 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 11
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013275.4-1829s21c1
Sequence:CCGGGAAGCGAAAGAAAGAAACAAACTCGAGTTTGTTTCTTTCTTTCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013275.4-9041s21c1
Sequence:CCGGCCGCGTGGTTTGTATCTTCTTCTCGAGAAGAAGATACAAACCACGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013275.4-5804s21c1
Sequence:CCGGGCCTCTCTCCACAAACCTTTACTCGAGTAAAGGTTTGTGGAGAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013275.4-2149s21c1
Sequence:CCGGGTTCTTTATCAGACTCCACAACTCGAGTTGTGGAGTCTGATAAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_013275.3-9022s1c1
Sequence:CCGGCCGTATTGAAATGGAGTCAAACTCGAGTTTGACTCCATTTCAATACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013275.3-1832s1c1
Sequence:CCGGGAAGCGAAAGAAAGAAACAAACTCGAGTTTGTTTCTTTCTTTCGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013275.3-2152s1c1
Sequence:CCGGGTTCTTTATCAGACTCCACAACTCGAGTTGTGGAGTCTGATAAAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013275.3-5807s1c1
Sequence:CCGGGCCTCTCTCCACAAACCTTTACTCGAGTAAAGGTTTGTGGAGAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013275.3-4660s1c1
Sequence:CCGGCGGATGCTTACGGAGTTTCTTCTCGAGAAGAAACTCCGTAAGCATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013275.3-8421s1c1
Sequence:CCGGGACGTCAACGACGACTTTGTACTCGAGTACAAAGTCGTCGTTGACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_013275.3-9044s1c1
Sequence:CCGGCCGCGTGGTTTGTATCTTCTTCTCGAGAAGAAGATACAAACCACGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013275
VALIDATED
ANKRD11 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 11
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013275.4-1829s21c1
Sequence:CCGGGAAGCGAAAGAAAGAAACAAACTCGAGTTTGTTTCTTTCTTTCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013275.4-9041s21c1
Sequence:CCGGCCGCGTGGTTTGTATCTTCTTCTCGAGAAGAAGATACAAACCACGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013275.4-5804s21c1
Sequence:CCGGGCCTCTCTCCACAAACCTTTACTCGAGTAAAGGTTTGTGGAGAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013275.4-2149s21c1
Sequence:CCGGGTTCTTTATCAGACTCCACAACTCGAGTTGTGGAGTCTGATAAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_013275.3-9022s1c1
Sequence:CCGGCCGTATTGAAATGGAGTCAAACTCGAGTTTGACTCCATTTCAATACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013275.3-1832s1c1
Sequence:CCGGGAAGCGAAAGAAAGAAACAAACTCGAGTTTGTTTCTTTCTTTCGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013275.3-2152s1c1
Sequence:CCGGGTTCTTTATCAGACTCCACAACTCGAGTTGTGGAGTCTGATAAAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013275.3-5807s1c1
Sequence:CCGGGCCTCTCTCCACAAACCTTTACTCGAGTAAAGGTTTGTGGAGAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013275.3-4660s1c1
Sequence:CCGGCGGATGCTTACGGAGTTTCTTCTCGAGAAGAAACTCCGTAAGCATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013275.3-8421s1c1
Sequence:CCGGGACGTCAACGACGACTTTGTACTCGAGTACAAAGTCGTCGTTGACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_013275.3-9044s1c1
Sequence:CCGGCCGCGTGGTTTGTATCTTCTTCTCGAGAAGAAGATACAAACCACGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013275
VALIDATED
ANKRD11 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 11
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013275.4-1829s21c1
Sequence:CCGGGAAGCGAAAGAAAGAAACAAACTCGAGTTTGTTTCTTTCTTTCGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013275.4-9041s21c1
Sequence:CCGGCCGCGTGGTTTGTATCTTCTTCTCGAGAAGAAGATACAAACCACGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013275.4-5804s21c1
Sequence:CCGGGCCTCTCTCCACAAACCTTTACTCGAGTAAAGGTTTGTGGAGAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013275.4-2149s21c1
Sequence:CCGGGTTCTTTATCAGACTCCACAACTCGAGTTGTGGAGTCTGATAAAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_013275.3-9022s1c1
Sequence:CCGGCCGTATTGAAATGGAGTCAAACTCGAGTTTGACTCCATTTCAATACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013275.3-1832s1c1
Sequence:CCGGGAAGCGAAAGAAAGAAACAAACTCGAGTTTGTTTCTTTCTTTCGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013275.3-2152s1c1
Sequence:CCGGGTTCTTTATCAGACTCCACAACTCGAGTTGTGGAGTCTGATAAAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013275.3-5807s1c1
Sequence:CCGGGCCTCTCTCCACAAACCTTTACTCGAGTAAAGGTTTGTGGAGAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013275.3-4660s1c1
Sequence:CCGGCGGATGCTTACGGAGTTTCTTCTCGAGAAGAAACTCCGTAAGCATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013275.3-8421s1c1
Sequence:CCGGGACGTCAACGACGACTTTGTACTCGAGTACAAAGTCGTCGTTGACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_013275.3-9044s1c1
Sequence:CCGGCCGCGTGGTTTGTATCTTCTTCTCGAGAAGAAGATACAAACCACGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081379
VALIDATED
ANKRD11 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081379.1-4545s21c1
Sequence:CCGGGAGGATAGAGAAGGAGTTAAACTCGAGTTTAACTCCTTCTCTATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081379.1-2185s21c1
Sequence:CCGGTCCGTCAGCCAAGAACTTAAACTCGAGTTTAAGTTCTTGGCTGACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081379.1-2678s21c1
Sequence:CCGGACGCTGCCTTTGATGACTATTCTCGAGAATAGTCATCAAAGGCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081379.1-8133s21c1
Sequence:CCGGCGTCAACGATGACTTCGTATTCTCGAGAATACGAAGTCATCGTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081379.1-8548s21c1
Sequence:CCGGCTAAGGCGTCCACCTTCATAACTCGAGTTATGAAGGTGGACGCCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081379
VALIDATED
ANKRD11 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081379.1-4545s21c1
Sequence:CCGGGAGGATAGAGAAGGAGTTAAACTCGAGTTTAACTCCTTCTCTATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081379.1-2185s21c1
Sequence:CCGGTCCGTCAGCCAAGAACTTAAACTCGAGTTTAAGTTCTTGGCTGACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081379.1-2678s21c1
Sequence:CCGGACGCTGCCTTTGATGACTATTCTCGAGAATAGTCATCAAAGGCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081379.1-8133s21c1
Sequence:CCGGCGTCAACGATGACTTCGTATTCTCGAGAATACGAAGTCATCGTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081379.1-8548s21c1
Sequence:CCGGCTAAGGCGTCCACCTTCATAACTCGAGTTATGAAGGTGGACGCCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081379
VALIDATED
ANKRD11 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081379.1-4545s21c1
Sequence:CCGGGAGGATAGAGAAGGAGTTAAACTCGAGTTTAACTCCTTCTCTATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081379.1-2185s21c1
Sequence:CCGGTCCGTCAGCCAAGAACTTAAACTCGAGTTTAAGTTCTTGGCTGACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081379.1-2678s21c1
Sequence:CCGGACGCTGCCTTTGATGACTATTCTCGAGAATAGTCATCAAAGGCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081379.1-8133s21c1
Sequence:CCGGCGTCAACGATGACTTCGTATTCTCGAGAATACGAAGTCATCGTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081379.1-8548s21c1
Sequence:CCGGCTAAGGCGTCCACCTTCATAACTCGAGTTATGAAGGTGGACGCCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)