EMAIL THIS PAGE TO A FRIEND

ANKRD20A3

ankyrin repeat domain 20 family, member A3

26 Gene Product Result for
Species: Human ANKRD20A3(441425)
UniProtKB ID: Q5VUR7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012419 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127301 MISSION® esiRNA esiRNA human ANKRD20A3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012419 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306134 predicted 2151
2 SASI_Hs02_00306135 predicted 726
3 SASI_Hs02_00306136 predicted 737
4 SASI_Hs01_00071051 predicted 776
5 SASI_Hs02_00306137 predicted 711
6 SASI_Hs02_00306138 predicted 938
7 SASI_Hs02_00306139 predicted 745
8 SASI_Hs01_00071050 predicted 2017
9 SASI_Hs01_00071052 predicted 1915
10 SASI_Hs02_00306140 predicted 2009
11 SASI_Hs01_00071043 predicted 908
12 SASI_Hs01_00071044 predicted 899
13 SASI_Hs01_00071045 predicted 902
14 SASI_Hs01_00071046 predicted 908
15 SASI_Hs01_00071047 predicted 894
16 SASI_Hs01_00071048 predicted 896
17 SASI_Hs01_00071049 predicted 901
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012419
ANKRD20A3 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 20 family, member A3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012419.1-458s1c1
Sequence:CCGGGCCGTTATTCTGCTGGAACATCTCGAGATGTTCCAGCAGAATAACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012419.1-518s1c1
Sequence:CCGGGCTCTCCATTATGCCGTGTATCTCGAGATACACGGCATAATGGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012419.1-954s1c1
Sequence:CCGGGTGTGGATTCATTGCCTGCATCTCGAGATGCAGGCAATGAATCCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012419.1-483s1c1
Sequence:CCGGCCAATCCAAACCTTAAGGATACTCGAGTATCCTTAAGGTTTGGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012419.1-1420s1c1
Sequence:CCGGGCATGATAGATGCACCTTAAACTCGAGTTTAAGGTGCATCTATCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012419.1-746s1c1
Sequence:CCGGCCAGGTATTGTCAATATCCTTCTCGAGAAGGATATTGACAATACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012419.1-1859s1c1
Sequence:CCGGGCTGAGAATACAAGGCTCAATCTCGAGATTGAGCCTTGTATTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012419.1-3571s1c1
Sequence:CCGGGCTGTCTGTGATTTACGAGTTCTCGAGAACTCGTAAATCACAGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012419.1-3514s1c1
Sequence:CCGGGCAAGGCTCAATGACTGTCATCTCGAGATGACAGTCATTGAGCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012419
ANKRD20A3 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 20 family, member A3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012419.1-458s1c1
Sequence:CCGGGCCGTTATTCTGCTGGAACATCTCGAGATGTTCCAGCAGAATAACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012419.1-518s1c1
Sequence:CCGGGCTCTCCATTATGCCGTGTATCTCGAGATACACGGCATAATGGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012419.1-954s1c1
Sequence:CCGGGTGTGGATTCATTGCCTGCATCTCGAGATGCAGGCAATGAATCCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012419.1-483s1c1
Sequence:CCGGCCAATCCAAACCTTAAGGATACTCGAGTATCCTTAAGGTTTGGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012419.1-1420s1c1
Sequence:CCGGGCATGATAGATGCACCTTAAACTCGAGTTTAAGGTGCATCTATCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012419.1-746s1c1
Sequence:CCGGCCAGGTATTGTCAATATCCTTCTCGAGAAGGATATTGACAATACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012419.1-1859s1c1
Sequence:CCGGGCTGAGAATACAAGGCTCAATCTCGAGATTGAGCCTTGTATTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012419.1-3571s1c1
Sequence:CCGGGCTGTCTGTGATTTACGAGTTCTCGAGAACTCGTAAATCACAGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012419.1-3514s1c1
Sequence:CCGGGCAAGGCTCAATGACTGTCATCTCGAGATGACAGTCATTGAGCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012419
ANKRD20A3 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 20 family, member A3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012419.1-458s1c1
Sequence:CCGGGCCGTTATTCTGCTGGAACATCTCGAGATGTTCCAGCAGAATAACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138852    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012419.1-518s1c1
Sequence:CCGGGCTCTCCATTATGCCGTGTATCTCGAGATACACGGCATAATGGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012419.1-954s1c1
Sequence:CCGGGTGTGGATTCATTGCCTGCATCTCGAGATGCAGGCAATGAATCCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012419.1-483s1c1
Sequence:CCGGCCAATCCAAACCTTAAGGATACTCGAGTATCCTTAAGGTTTGGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012419.1-1420s1c1
Sequence:CCGGGCATGATAGATGCACCTTAAACTCGAGTTTAAGGTGCATCTATCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012419.1-746s1c1
Sequence:CCGGCCAGGTATTGTCAATATCCTTCTCGAGAAGGATATTGACAATACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012419.1-1859s1c1
Sequence:CCGGGCTGAGAATACAAGGCTCAATCTCGAGATTGAGCCTTGTATTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012419.1-3571s1c1
Sequence:CCGGGCTGTCTGTGATTTACGAGTTCTCGAGAACTCGTAAATCACAGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012419.1-3514s1c1
Sequence:CCGGGCAAGGCTCAATGACTGTCATCTCGAGATGACAGTCATTGAGCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)