EMAIL THIS PAGE TO A FRIEND

ANKRD20A4

ankyrin repeat domain 20 family, member A4

14 Gene Product Result for
Species: Human ANKRD20A4(728747)
UniProtKB ID: Q4UJ75
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098805 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098805 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098805 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098805 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319929 predicted 1913
2 SASI_Hs02_00319930 predicted 2148
3 SASI_Hs02_00319931 predicted 728
4 SASI_Hs02_00319932 predicted 740
5 SASI_Hs02_00319933 predicted 774
6 SASI_Hs02_00319934 predicted 2006
7 SASI_Hs02_00319935 predicted 715
8 SASI_Hs02_00319936 predicted 935
9 SASI_Hs02_00319937 predicted 743
10 SASI_Hs02_00319938 predicted 2426
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098805
VALIDATED
ANKRD20A4 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 20 family, member A4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098805.1-1147s21c1
Sequence:CCGGTGTGAAAGGAGCAGTACAAAGCTCGAGCTTTGTACTGCTCCTTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098805.1-735s21c1
Sequence:CCGGACTATGACTCACCAGGTATTGCTCGAGCAATACCTGGTGAGTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098805.1-3042s21c1
Sequence:CCGGATTAGGCACAGAGTCATATTTCTCGAGAAATATGACTCTGTGCCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098805.1-2365s21c1
Sequence:CCGGTCATCAGAAAGAGGATCATAACTCGAGTTATGATCCTCTTTCTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098805.1-813s21c1
Sequence:CCGGATGCAGAAGATTATGCTATTTCTCGAGAAATAGCATAATCTTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098805
VALIDATED
ANKRD20A4 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 20 family, member A4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098805.1-1147s21c1
Sequence:CCGGTGTGAAAGGAGCAGTACAAAGCTCGAGCTTTGTACTGCTCCTTTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098805.1-735s21c1
Sequence:CCGGACTATGACTCACCAGGTATTGCTCGAGCAATACCTGGTGAGTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098805.1-3042s21c1
Sequence:CCGGATTAGGCACAGAGTCATATTTCTCGAGAAATATGACTCTGTGCCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098805.1-2365s21c1
Sequence:CCGGTCATCAGAAAGAGGATCATAACTCGAGTTATGATCCTCTTTCTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098805.1-813s21c1
Sequence:CCGGATGCAGAAGATTATGCTATTTCTCGAGAAATAGCATAATCTTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098805
VALIDATED
ANKRD20A4 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 20 family, member A4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098805.1-1147s21c1
Sequence:CCGGTGTGAAAGGAGCAGTACAAAGCTCGAGCTTTGTACTGCTCCTTTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098805.1-735s21c1
Sequence:CCGGACTATGACTCACCAGGTATTGCTCGAGCAATACCTGGTGAGTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098805.1-3042s21c1
Sequence:CCGGATTAGGCACAGAGTCATATTTCTCGAGAAATATGACTCTGTGCCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098805.1-2365s21c1
Sequence:CCGGTCATCAGAAAGAGGATCATAACTCGAGTTATGATCCTCTTTCTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098805.1-813s21c1
Sequence:CCGGATGCAGAAGATTATGCTATTTCTCGAGAAATAGCATAATCTTCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)