ANKRD30A

MISSION^® siRNAs have been designed using a world-class siRNA design algorithm licensed from Rosetta Inpharmatics, a leader in advanced siRNA research. The Rosetta-powered siRNA design algorithm has been optimized with over 3 years of continuous development for enhanced performance in RNAi applications. New and critical siRNA design rules incorporated into the latest algorithm lead to increased target specificity and knockdown for low abundance messages.

Validated MISSION^® siRNAs have been functionally validated in Hela cells by Sigma scientists to Knockdown gene expression by 75% or greater. With Validated MISSION^® siRNAs, we have done the upfront validation work, so that you do not have to.

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB4503552	Anti-AN30A antibody produced in rabbit affinity isolated antibody	human	ELISA, western blot	pricing

Proteins

Product #	Description	Species	Add to Cart

QPREST35604	SILu^™PrEST AN30A SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_052997	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_052997	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_052997	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU104501	MISSION^® esiRNA targeting human ANKRD30BL	human	pricing

EHU127831	MISSION^® esiRNA targeting human ANKRD30A	human	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_052997	Rosetta Predictions	human	pricing

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00177797 predicted	1106
2	SASI_Hs02_00361814 predicted	1366
3	SASI_Hs02_00361815 predicted	1087
4	SASI_Hs01_00177800 predicted	624
5	SASI_Hs02_00361816 predicted	1930
6	SASI_Hs02_00361817 predicted	1003
7	SASI_Hs01_00177802 predicted	636
8	SASI_Hs02_00361818 predicted	557
9	SASI_Hs01_00177805 predicted	308
10	SASI_Hs01_00177798 predicted	3362
11	SASI_Hs01_00177799 predicted	3872
12	SASI_Hs01_00177801 predicted	3605
13	SASI_Hs01_00177803 predicted	3682
14	SASI_Hs01_00177804 predicted	3889
15	SASI_Hs01_00177806 predicted	3979

TRC Number
We do not support the configuration options you have chosen
TRCN0000370723
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-682s21c1
	Sequence:CCGGCATCACATTCATGAACAAATTCTCGAGAATTTGTTCATGAATGTGATGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000365469
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-308s21c1
	Sequence:CCGGTAGATTCTGGTGCCGATATAACTCGAGTTATATCGGCACCAGAATCTATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022239
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_052997.1-1763s1c1
	Sequence:CCGGCCTGCGGAATGAAAGTTTCTACTCGAGTAGAAACTTTCATTCCGCAGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022240
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_052997.1-628s1c1
	Sequence:CCGGGCTGCAGATATATGTGGAGTACTCGAGTACTCCACATATATCTGCAGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022241
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_052997.1-2121s1c1
	Sequence:CCGGCTGCGGAATGAAAGTTTCTATCTCGAGATAGAAACTTTCATTCCGCAGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000370724
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-3384s21c1
	Sequence:CCGGACTGAAAGAGGAATCATTAACCTCGAGGTTAATGATTCCTCTTTCAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000365467
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-620s21c1
	Sequence:CCGGACGTCTTTGCTGCAGATATATCTCGAGATATATCTGCAGCAAAGACGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000365470
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-281s21c1
	Sequence:CCGGATCAGGAGGCTTGTGCAAATACTCGAGTATTTGCACAAGCCTCCTGATTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000365471
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-1765s21c1
	Sequence:CCGGTGCGGAATGAAAGTTTCTATTCTCGAGAATAGAAACTTTCATTCCGCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000365468
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_052997.2-4199s21c1
	Sequence:CCGGCAGTCCTAGCATCACCTTATGCTCGAGCATAAGGTGATGCTAGGACTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000370725
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-1098s21c1
	Sequence:CCGGAGACACACCTAGGGAAATTATCTCGAGATAATTTCCCTAGGTGTGTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

TRC Number		Vector
We do not support the configuration options you have chosen
TRCN0000370723
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-682s21c1
	Sequence:CCGGCATCACATTCATGAACAAATTCTCGAGAATTTGTTCATGAATGTGATGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000365469
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-308s21c1
	Sequence:CCGGTAGATTCTGGTGCCGATATAACTCGAGTTATATCGGCACCAGAATCTATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000022239
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_052997.1-1763s1c1
	Sequence:CCGGCCTGCGGAATGAAAGTTTCTACTCGAGTAGAAACTTTCATTCCGCAGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000022240
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_052997.1-628s1c1
	Sequence:CCGGGCTGCAGATATATGTGGAGTACTCGAGTACTCCACATATATCTGCAGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000022241
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_052997.1-2121s1c1
	Sequence:CCGGCTGCGGAATGAAAGTTTCTATCTCGAGATAGAAACTTTCATTCCGCAGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000370724
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-3384s21c1
	Sequence:CCGGACTGAAAGAGGAATCATTAACCTCGAGGTTAATGATTCCTCTTTCAGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000365467
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-620s21c1
	Sequence:CCGGACGTCTTTGCTGCAGATATATCTCGAGATATATCTGCAGCAAAGACGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000365470
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-281s21c1
	Sequence:CCGGATCAGGAGGCTTGTGCAAATACTCGAGTATTTGCACAAGCCTCCTGATTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000365471
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-1765s21c1
	Sequence:CCGGTGCGGAATGAAAGTTTCTATTCTCGAGAATAGAAACTTTCATTCCGCATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000365468
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_052997.2-4199s21c1
	Sequence:CCGGCAGTCCTAGCATCACCTTATGCTCGAGCATAAGGTGATGCTAGGACTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000370725
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-1098s21c1
	Sequence:CCGGAGACACACCTAGGGAAATTATCTCGAGATAATTTCCCTAGGTGTGTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

TRC Number	Volume	Vector
We do not support the configuration options you have chosen
TRCN0000370723
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-682s21c1
	Sequence:CCGGCATCACATTCATGAACAAATTCTCGAGAATTTGTTCATGAATGTGATGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000365469
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-308s21c1
	Sequence:CCGGTAGATTCTGGTGCCGATATAACTCGAGTTATATCGGCACCAGAATCTATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022239
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_052997.1-1763s1c1
	Sequence:CCGGCCTGCGGAATGAAAGTTTCTACTCGAGTAGAAACTTTCATTCCGCAGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022240
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_052997.1-628s1c1
	Sequence:CCGGGCTGCAGATATATGTGGAGTACTCGAGTACTCCACATATATCTGCAGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000022241
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_052997.1-2121s1c1
	Sequence:CCGGCTGCGGAATGAAAGTTTCTATCTCGAGATAGAAACTTTCATTCCGCAGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000370724
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-3384s21c1
	Sequence:CCGGACTGAAAGAGGAATCATTAACCTCGAGGTTAATGATTCCTCTTTCAGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000365467
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-620s21c1
	Sequence:CCGGACGTCTTTGCTGCAGATATATCTCGAGATATATCTGCAGCAAAGACGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000365470
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-281s21c1
	Sequence:CCGGATCAGGAGGCTTGTGCAAATACTCGAGTATTTGCACAAGCCTCCTGATTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000365471
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-1765s21c1
	Sequence:CCGGTGCGGAATGAAAGTTTCTATTCTCGAGAATAGAAACTTTCATTCCGCATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000365468
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_052997.2-4199s21c1
	Sequence:CCGGCAGTCCTAGCATCACCTTATGCTCGAGCATAAGGTGATGCTAGGACTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000370725
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_052997.2-1098s21c1
	Sequence:CCGGAGACACACCTAGGGAAATTATCTCGAGATAATTTCCCTAGGTGTGTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

ankyrin repeat domain 30A