EMAIL THIS PAGE TO A FRIEND

ANKRD34A

ankyrin repeat domain 34A

119 Gene Product Result for
Synonyms: ANKRD34
UniProtKB ID: Q69YU3, B3KSU3
Gene ID:
Mouse(545554) ankyrin repeat domain 34A
Rat(295283) ankyrin repeat domain 34A
dog(475828) ankyrin repeat domain 34A
domestic cat(101099232) ankyrin repeat domain 34A
Horse(100065323) ankyrin repeat domain 34A
cow(538433) ankyrin repeat domain 34A
naked mole-rat(101703997) ankyrin repeat domain 34A
domestic guinea pig(100732249) ankyrin repeat domain 34A
sheep(101118396) ankyrin repeat domain 34A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039888 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU146401 MISSION® esiRNA esiRNA targeting mouse Ankrd34a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039888 Rosetta Predictions human pricing
NM_001024980 Rosetta Predictions rat pricing
NM_001024851 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029039 predicted 2992
2 SASI_Hs01_00029041 predicted 2958
3 SASI_Hs01_00029042 predicted 2927
4 SASI_Hs01_00029043 predicted 1749
5 SASI_Hs01_00029046 predicted 1766
6 SASI_Hs02_00308709 predicted 3020
7 SASI_Hs01_00029047 predicted 2932
8 SASI_Hs02_00308710 predicted 2913
9 SASI_Hs02_00308711 predicted 2681
10 SASI_Hs02_00308712 predicted 2810
11 SASI_Hs01_00029038 predicted 2953
12 SASI_Hs01_00029040 predicted 3192
13 SASI_Hs01_00029044 predicted 2966
14 SASI_Hs01_00029045 predicted 3182
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024980 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202854 predicted 1797
2 SASI_Rn01_00046140 predicted 793
3 SASI_Rn01_00046141 predicted 1833
4 SASI_Rn01_00046143 predicted 709
5 SASI_Rn01_00046144 predicted 1783
6 SASI_Rn01_00046145 predicted 1556
7 SASI_Rn01_00046146 predicted 2055
8 SASI_Rn02_00202855 predicted 787
9 SASI_Rn01_00046148 predicted 1760
10 SASI_Rn01_00046149 predicted 1690
11 SASI_Rn01_00046142 predicted 1848
12 SASI_Rn01_00046147 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287726 predicted 2099
2 SASI_Mm01_00148178 predicted 348
3 SASI_Mm01_00148179 predicted 1032
4 SASI_Mm01_00148180 predicted 429
5 SASI_Mm01_00148181 predicted 1240
6 SASI_Mm02_00287727 predicted 1990
7 SASI_Mm02_00287728 predicted 1677
8 SASI_Mm01_00148184 predicted 515
9 SASI_Mm02_00287729 predicted 2069
10 SASI_Mm01_00148185 predicted 1109
11 SASI_Mm01_00148182 predicted 821
12 SASI_Mm01_00148183 predicted 808
13 SASI_Mm01_00148186 predicted 445
14 SASI_Mm01_00148187 predicted 1189
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039888
ANKRD34A MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 34A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039888.2-1757s21c1
Sequence:CCGGAGACCCGGCAGTATCTCAATTCTCGAGAATTGAGATACTGCCGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039888.2-2676s21c1
Sequence:CCGGTCCCAGGACCAAGCGCAAATTCTCGAGAATTTGCGCTTGGTCCTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039888.2-1501s21c1
Sequence:CCGGCCCAATATCGCAGACCGATTACTCGAGTAATCGGTCTGCGATATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039888.2-1915s21c1
Sequence:CCGGGAGGAGAAGCGGGACGTATTTCTCGAGAAATACGTCCCGCTTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039888.2-2970s21c1
Sequence:CCGGACTCTATTTACTGGGTATATACTCGAGTATATACCCAGTAAATAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039888
ANKRD34A MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 34A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039888.2-1757s21c1
Sequence:CCGGAGACCCGGCAGTATCTCAATTCTCGAGAATTGAGATACTGCCGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039888.2-2676s21c1
Sequence:CCGGTCCCAGGACCAAGCGCAAATTCTCGAGAATTTGCGCTTGGTCCTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039888.2-1501s21c1
Sequence:CCGGCCCAATATCGCAGACCGATTACTCGAGTAATCGGTCTGCGATATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039888.2-1915s21c1
Sequence:CCGGGAGGAGAAGCGGGACGTATTTCTCGAGAAATACGTCCCGCTTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039888.2-2970s21c1
Sequence:CCGGACTCTATTTACTGGGTATATACTCGAGTATATACCCAGTAAATAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039888
ANKRD34A MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 34A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039888.2-1757s21c1
Sequence:CCGGAGACCCGGCAGTATCTCAATTCTCGAGAATTGAGATACTGCCGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039888.2-2676s21c1
Sequence:CCGGTCCCAGGACCAAGCGCAAATTCTCGAGAATTTGCGCTTGGTCCTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039888.2-1501s21c1
Sequence:CCGGCCCAATATCGCAGACCGATTACTCGAGTAATCGGTCTGCGATATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039888.2-1915s21c1
Sequence:CCGGGAGGAGAAGCGGGACGTATTTCTCGAGAAATACGTCCCGCTTCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039888.2-2970s21c1
Sequence:CCGGACTCTATTTACTGGGTATATACTCGAGTATATACCCAGTAAATAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024851
ANKRD34A MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 34A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024851.1-727s1c1
Sequence:CCGGCAAGAAGACCAGGCAGTATCTCTCGAGAGATACTGCCTGGTCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024851.1-2313s1c1
Sequence:CCGGGCTCCCAATCTCACTTCTGTTCTCGAGAACAGAAGTGAGATTGGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024851.1-730s1c1
Sequence:CCGGGAAGACCAGGCAGTATCTTAACTCGAGTTAAGATACTGCCTGGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024851.1-2277s1c1
Sequence:CCGGGATGTCTTCTTCACTGTTCTTCTCGAGAAGAACAGTGAAGAAGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024851.1-689s1c1
Sequence:CCGGGTCATCATCATAACGACGGATCTCGAGATCCGTCGTTATGATGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024851
ANKRD34A MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 34A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024851.1-727s1c1
Sequence:CCGGCAAGAAGACCAGGCAGTATCTCTCGAGAGATACTGCCTGGTCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024851.1-2313s1c1
Sequence:CCGGGCTCCCAATCTCACTTCTGTTCTCGAGAACAGAAGTGAGATTGGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024851.1-730s1c1
Sequence:CCGGGAAGACCAGGCAGTATCTTAACTCGAGTTAAGATACTGCCTGGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024851.1-2277s1c1
Sequence:CCGGGATGTCTTCTTCACTGTTCTTCTCGAGAAGAACAGTGAAGAAGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024851.1-689s1c1
Sequence:CCGGGTCATCATCATAACGACGGATCTCGAGATCCGTCGTTATGATGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024851
ANKRD34A MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 34A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024851.1-727s1c1
Sequence:CCGGCAAGAAGACCAGGCAGTATCTCTCGAGAGATACTGCCTGGTCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024851.1-2313s1c1
Sequence:CCGGGCTCCCAATCTCACTTCTGTTCTCGAGAACAGAAGTGAGATTGGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024851.1-730s1c1
Sequence:CCGGGAAGACCAGGCAGTATCTTAACTCGAGTTAAGATACTGCCTGGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024851.1-2277s1c1
Sequence:CCGGGATGTCTTCTTCACTGTTCTTCTCGAGAAGAACAGTGAAGAAGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024851.1-689s1c1
Sequence:CCGGGTCATCATCATAACGACGGATCTCGAGATCCGTCGTTATGATGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)