EMAIL THIS PAGE TO A FRIEND

ANKRD36

ankyrin repeat domain 36

232 Gene Product Result for
Synonyms: UNQ2430
UniProtKB ID: A6QL64, B4E3I8, Q6UX02, Q86X62, Q9HCD1
Gene ID:
Mouse(76389) ankyrin repeat domain 36
Rat(305491) ankyrin repeat domain 36
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA057661 Anti-ANKRD36 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001164315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001164315 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023816 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023816 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023816 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198555 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198555 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198555 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU187941 MISSION® esiRNA esiRNA targeting mouse Ankrd36 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198555 Rosetta Predictions human pricing
NM_198684 Rosetta Predictions rat pricing
NM_023816 Rosetta Predictions mouse pricing
XM_125967 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372168 predicted 596
2 SASI_Hs02_00372169 predicted 601
3 SASI_Hs02_00372170 predicted 607
4 SASI_Hs02_00372171 predicted 696
5 SASI_Hs01_00058199 predicted 787
6 SASI_Hs01_00058200 predicted 951
7 SASI_Hs01_00058201 predicted 660
8 SASI_Hs01_00058202 predicted 790
9 SASI_Hs01_00058203 predicted 964
10 SASI_Hs01_00058204 predicted 1122
11 SASI_Hs01_00058205 predicted 1455
12 SASI_Hs01_00058206 predicted 681
13 SASI_Hs01_00058207 predicted 1376
14 SASI_Hs01_00058208 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086128 predicted 270
2 SASI_Rn01_00086129 predicted 1223
3 SASI_Rn01_00086130 predicted 898
4 SASI_Rn01_00086132 predicted 1352
5 SASI_Rn01_00086133 predicted 1330
6 SASI_Rn02_00269925 predicted 1095
7 SASI_Rn01_00086136 predicted 1488
8 SASI_Rn01_00086137 predicted 559
9 SASI_Rn02_00269926 predicted 1246
10 SASI_Rn02_00269927 predicted 1049
11 SASI_Rn01_00086131 predicted 1017
12 SASI_Rn01_00086134 predicted 1094
13 SASI_Rn01_00086135 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327371 predicted 404
2 SASI_Mm02_00327372 predicted 4249
3 SASI_Mm02_00327373 predicted 1675
4 SASI_Mm02_00327374 predicted 2129
5 SASI_Mm02_00327375 predicted 1939
6 SASI_Mm02_00327376 predicted 4148
7 SASI_Mm02_00327377 predicted 3344
8 SASI_Mm02_00327378 predicted 2986
9 SASI_Mm02_00327379 predicted 924
10 SASI_Mm02_00327380 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125967 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257136 predicted 4253
2 SASI_Mm01_00257137 predicted 1678
3 SASI_Mm01_00257138 predicted 1265
4 SASI_Mm01_00257139 predicted 1732
5 SASI_Mm01_00257140 predicted 2135
6 SASI_Mm01_00257141 predicted 1945
7 SASI_Mm01_00257142 predicted 2784
8 SASI_Mm01_00257143 predicted 4151
9 SASI_Mm01_00257144 predicted 3356
10 SASI_Mm01_00257145 predicted 2985
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164315
ANKRD36 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 36
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-1524s21c1
Sequence:CCGGTTACGAACAGAAGGACTATTTCTCGAGAAATAGTCCTTCTGTTCGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-5372s21c1
Sequence:CCGGCACGTGCAAAGTGAGCTAAAGCTCGAGCTTTAGCTCACTTTGCACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-5155s21c1
Sequence:CCGGTCGATGTGATCATGATCAAAGCTCGAGCTTTGATCATGATCACATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-5810s21c1
Sequence:CCGGTCGCGTCACTGCACCTATTTACTCGAGTAAATAGGTGCAGTGACGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-392s21c1
Sequence:CCGGTACCTTCTGCTCACGTATTATCTCGAGATAATACGTGAGCAGAAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164315.1-6071s21c1
Sequence:CCGGATGAAGATATGGACATTTCTGCTCGAGCAGAAATGTCCATATCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-1677s21c1
Sequence:CCGGCTCCTGAGCAACCGCCTTTATCTCGAGATAAAGGCGGTTGCTCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164315
ANKRD36 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 36
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-1524s21c1
Sequence:CCGGTTACGAACAGAAGGACTATTTCTCGAGAAATAGTCCTTCTGTTCGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-5372s21c1
Sequence:CCGGCACGTGCAAAGTGAGCTAAAGCTCGAGCTTTAGCTCACTTTGCACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-5155s21c1
Sequence:CCGGTCGATGTGATCATGATCAAAGCTCGAGCTTTGATCATGATCACATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-5810s21c1
Sequence:CCGGTCGCGTCACTGCACCTATTTACTCGAGTAAATAGGTGCAGTGACGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-392s21c1
Sequence:CCGGTACCTTCTGCTCACGTATTATCTCGAGATAATACGTGAGCAGAAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164315.1-6071s21c1
Sequence:CCGGATGAAGATATGGACATTTCTGCTCGAGCAGAAATGTCCATATCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-1677s21c1
Sequence:CCGGCTCCTGAGCAACCGCCTTTATCTCGAGATAAAGGCGGTTGCTCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164315
ANKRD36 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 36
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-1524s21c1
Sequence:CCGGTTACGAACAGAAGGACTATTTCTCGAGAAATAGTCCTTCTGTTCGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-5372s21c1
Sequence:CCGGCACGTGCAAAGTGAGCTAAAGCTCGAGCTTTAGCTCACTTTGCACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-5155s21c1
Sequence:CCGGTCGATGTGATCATGATCAAAGCTCGAGCTTTGATCATGATCACATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-5810s21c1
Sequence:CCGGTCGCGTCACTGCACCTATTTACTCGAGTAAATAGGTGCAGTGACGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-392s21c1
Sequence:CCGGTACCTTCTGCTCACGTATTATCTCGAGATAATACGTGAGCAGAAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164315.1-6071s21c1
Sequence:CCGGATGAAGATATGGACATTTCTGCTCGAGCAGAAATGTCCATATCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164315.1-1677s21c1
Sequence:CCGGCTCCTGAGCAACCGCCTTTATCTCGAGATAAAGGCGGTTGCTCAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023816
ANKRD36 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 36
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023816.1-1151s1c1
Sequence:CCGGGCTTGTACATTCCTTTAGTTACTCGAGTAACTAAAGGAATGTACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023816.1-814s1c1
Sequence:CCGGCCAACATAAACGCCCTGGATACTCGAGTATCCAGGGCGTTTATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023816.1-390s1c1
Sequence:CCGGGTGCAGAAGATGCTCGAATTTCTCGAGAAATTCGAGCATCTTCTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023816.1-813s1c1
Sequence:CCGGGCCAACATAAACGCCCTGGATCTCGAGATCCAGGGCGTTTATGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023816.1-946s1c1
Sequence:CCGGCTGCACAAAGTTACGCTGTTTCTCGAGAAACAGCGTAACTTTGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023816
ANKRD36 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 36
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023816.1-1151s1c1
Sequence:CCGGGCTTGTACATTCCTTTAGTTACTCGAGTAACTAAAGGAATGTACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023816.1-814s1c1
Sequence:CCGGCCAACATAAACGCCCTGGATACTCGAGTATCCAGGGCGTTTATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023816.1-390s1c1
Sequence:CCGGGTGCAGAAGATGCTCGAATTTCTCGAGAAATTCGAGCATCTTCTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023816.1-813s1c1
Sequence:CCGGGCCAACATAAACGCCCTGGATCTCGAGATCCAGGGCGTTTATGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023816.1-946s1c1
Sequence:CCGGCTGCACAAAGTTACGCTGTTTCTCGAGAAACAGCGTAACTTTGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023816
ANKRD36 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 36
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023816.1-1151s1c1
Sequence:CCGGGCTTGTACATTCCTTTAGTTACTCGAGTAACTAAAGGAATGTACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023816.1-814s1c1
Sequence:CCGGCCAACATAAACGCCCTGGATACTCGAGTATCCAGGGCGTTTATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023816.1-390s1c1
Sequence:CCGGGTGCAGAAGATGCTCGAATTTCTCGAGAAATTCGAGCATCTTCTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023816.1-813s1c1
Sequence:CCGGGCCAACATAAACGCCCTGGATCTCGAGATCCAGGGCGTTTATGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023816.1-946s1c1
Sequence:CCGGCTGCACAAAGTTACGCTGTTTCTCGAGAAACAGCGTAACTTTGTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198555
ANKRD36 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 36
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000155910    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198555.1-2653s1c1
Sequence:CCGGCCACAAGTGATGAGAAGGATTCTCGAGAATCCTTCTCATCACTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198555.1-1119s1c1
Sequence:CCGGGATACAAGTGACAAGGATGATCTCGAGATCATCCTTGTCACTTGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198555.1-1347s1c1
Sequence:CCGGGATGTGCTTCCTCCTATTGAACTCGAGTTCAATAGGAGGAAGCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198555
ANKRD36 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 36
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000155910    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198555.1-2653s1c1
Sequence:CCGGCCACAAGTGATGAGAAGGATTCTCGAGAATCCTTCTCATCACTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198555.1-1119s1c1
Sequence:CCGGGATACAAGTGACAAGGATGATCTCGAGATCATCCTTGTCACTTGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198555.1-1347s1c1
Sequence:CCGGGATGTGCTTCCTCCTATTGAACTCGAGTTCAATAGGAGGAAGCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198555
ANKRD36 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 36
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000155910    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198555.1-2653s1c1
Sequence:CCGGCCACAAGTGATGAGAAGGATTCTCGAGAATCCTTCTCATCACTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198555.1-1119s1c1
Sequence:CCGGGATACAAGTGACAAGGATGATCTCGAGATCATCCTTGTCACTTGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198555.1-1347s1c1
Sequence:CCGGGATGTGCTTCCTCCTATTGAACTCGAGTTCAATAGGAGGAAGCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)