EMAIL THIS PAGE TO A FRIEND

ANKRD39

ankyrin repeat domain 39

53 Gene Product Result for
UniProtKB ID: Q53RE8, Q59FU2, Q8N5X5, Q9P0S5
Gene ID:
Mouse(109346) ankyrin repeat domain 39
Rat(367251) ankyrin repeat domain 39
sheep(101113669) ankyrin repeat domain 39
naked mole-rat(101711876) ankyrin repeat domain 39
domestic guinea pig(100716270) ankyrin repeat domain 39
Zebrafish(100000333) ankyrin repeat domain 39
cow(510840) ankyrin repeat domain 39
domestic cat(101097310) ankyrin repeat domain 39
dog(474568) ankyrin repeat domain 39
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016466 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026241 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026241 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026241 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU198671 MISSION® esiRNA esiRNA targeting mouse Ankrd39 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016466 Rosetta Predictions human pricing
NM_001135014 Rosetta Predictions rat pricing
NM_026241 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234756 predicted 219
2 SASI_Hs01_00234757 predicted 530
3 SASI_Hs01_00234759 predicted 415
4 SASI_Hs01_00234760 predicted 342
5 SASI_Hs01_00234758 predicted 336
6 SASI_Hs01_00234762 predicted 511
7 SASI_Hs01_00234763 predicted 214
8 SASI_Hs01_00234764 predicted 529
9 SASI_Hs01_00234765 predicted 282
10 SASI_Hs02_00349512 predicted 420
11 SASI_Hs01_00234761 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001135014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259460 predicted 499
2 SASI_Rn02_00259461 predicted 213
3 SASI_Rn02_00259462 predicted 342
4 SASI_Rn02_00259463 predicted 420
5 SASI_Rn02_00259464 predicted 602
6 SASI_Rn02_00259465 predicted 246
7 SASI_Rn02_00259466 predicted 257
8 SASI_Rn02_00259467 predicted 805
9 SASI_Rn02_00259468 predicted 256
10 SASI_Rn02_00259469 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195997 predicted 438
2 SASI_Mm02_00329925 predicted 1014
3 SASI_Mm01_00195998 predicted 586
4 SASI_Mm01_00195999 predicted 808
5 SASI_Mm01_00196000 predicted 329
6 SASI_Mm01_00196001 predicted 812
7 SASI_Mm01_00196002 predicted 474
8 SASI_Mm01_00196003 predicted 1022
9 SASI_Mm01_00196004 predicted 759
10 SASI_Mm01_00196005 predicted 747
11 SASI_Mm01_00196006 predicted 437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016466
VALIDATED
ANKRD39 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 39
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016466.5-347s21c1
Sequence:CCGGCTACTGCGGGCACACTGAAATCTCGAGATTTCAGTGTGCCCGCAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016466.5-280s21c1
Sequence:CCGGTGCTGGAAAGCGGAGCTAAGTCTCGAGACTTAGCTCCGCTTTCCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016466.5-419s21c1
Sequence:CCGGCGGCATGACCAGTCTGCATAACTCGAGTTATGCAGACTGGTCATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016466.5-164s21c1
Sequence:CCGGGGGCCGAGTGAAGCATTTAATCTCGAGATTAAATGCTTCACTCGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016466.5-720s21c1
Sequence:CCGGTGGAAGCGAGGGAGTAGATTTCTCGAGAAATCTACTCCCTCGCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016466.4-168s1c1
Sequence:CCGGGCATTTAATCCAGAAGGCCGACTCGAGTCGGCCTTCTGGATTAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016466.4-277s1c1
Sequence:CCGGGAAAGCGGAGCTAAGTGTGATCTCGAGATCACACTTAGCTCCGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180344    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016466.4-595s1c1
Sequence:CCGGGCTGCCTTTAAAGGGTACACACTCGAGTGTGTACCCTTTAAAGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016466
VALIDATED
ANKRD39 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 39
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016466.5-347s21c1
Sequence:CCGGCTACTGCGGGCACACTGAAATCTCGAGATTTCAGTGTGCCCGCAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016466.5-280s21c1
Sequence:CCGGTGCTGGAAAGCGGAGCTAAGTCTCGAGACTTAGCTCCGCTTTCCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016466.5-419s21c1
Sequence:CCGGCGGCATGACCAGTCTGCATAACTCGAGTTATGCAGACTGGTCATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016466.5-164s21c1
Sequence:CCGGGGGCCGAGTGAAGCATTTAATCTCGAGATTAAATGCTTCACTCGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016466.5-720s21c1
Sequence:CCGGTGGAAGCGAGGGAGTAGATTTCTCGAGAAATCTACTCCCTCGCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016466.4-168s1c1
Sequence:CCGGGCATTTAATCCAGAAGGCCGACTCGAGTCGGCCTTCTGGATTAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016466.4-277s1c1
Sequence:CCGGGAAAGCGGAGCTAAGTGTGATCTCGAGATCACACTTAGCTCCGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180344    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016466.4-595s1c1
Sequence:CCGGGCTGCCTTTAAAGGGTACACACTCGAGTGTGTACCCTTTAAAGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016466
VALIDATED
ANKRD39 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 39
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016466.5-347s21c1
Sequence:CCGGCTACTGCGGGCACACTGAAATCTCGAGATTTCAGTGTGCCCGCAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016466.5-280s21c1
Sequence:CCGGTGCTGGAAAGCGGAGCTAAGTCTCGAGACTTAGCTCCGCTTTCCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016466.5-419s21c1
Sequence:CCGGCGGCATGACCAGTCTGCATAACTCGAGTTATGCAGACTGGTCATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016466.5-164s21c1
Sequence:CCGGGGGCCGAGTGAAGCATTTAATCTCGAGATTAAATGCTTCACTCGGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242748    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016466.5-720s21c1
Sequence:CCGGTGGAAGCGAGGGAGTAGATTTCTCGAGAAATCTACTCCCTCGCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016466.4-168s1c1
Sequence:CCGGGCATTTAATCCAGAAGGCCGACTCGAGTCGGCCTTCTGGATTAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016466.4-277s1c1
Sequence:CCGGGAAAGCGGAGCTAAGTGTGATCTCGAGATCACACTTAGCTCCGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180344    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016466.4-595s1c1
Sequence:CCGGGCTGCCTTTAAAGGGTACACACTCGAGTGTGTACCCTTTAAAGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026241
ANKRD39 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat domain 39
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026241.1-245s1c1
Sequence:CCGGCTATGCTGTTTGCCAGTTTCTCTCGAGAGAAACTGGCAAACAGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026241.1-1231s1c1
Sequence:CCGGCCTGTGTTCAATCCCTACTATCTCGAGATAGTAGGGATTGAACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026241.1-155s1c1
Sequence:CCGGTGTGAAGTATTTCATCCAGAACTCGAGTTCTGGATGAAATACTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026241.1-404s1c1
Sequence:CCGGTGGCATGACCAGTCTGCATAACTCGAGTTATGCAGACTGGTCATGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026241.1-433s1c1
Sequence:CCGGAGAAGGGTCACGAGGACATTTCTCGAGAAATGTCCTCGTGACCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026241
ANKRD39 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat domain 39
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026241.1-245s1c1
Sequence:CCGGCTATGCTGTTTGCCAGTTTCTCTCGAGAGAAACTGGCAAACAGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026241.1-1231s1c1
Sequence:CCGGCCTGTGTTCAATCCCTACTATCTCGAGATAGTAGGGATTGAACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026241.1-155s1c1
Sequence:CCGGTGTGAAGTATTTCATCCAGAACTCGAGTTCTGGATGAAATACTTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026241.1-404s1c1
Sequence:CCGGTGGCATGACCAGTCTGCATAACTCGAGTTATGCAGACTGGTCATGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026241.1-433s1c1
Sequence:CCGGAGAAGGGTCACGAGGACATTTCTCGAGAAATGTCCTCGTGACCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026241
ANKRD39 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat domain 39
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026241.1-245s1c1
Sequence:CCGGCTATGCTGTTTGCCAGTTTCTCTCGAGAGAAACTGGCAAACAGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026241.1-1231s1c1
Sequence:CCGGCCTGTGTTCAATCCCTACTATCTCGAGATAGTAGGGATTGAACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026241.1-155s1c1
Sequence:CCGGTGTGAAGTATTTCATCCAGAACTCGAGTTCTGGATGAAATACTTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026241.1-404s1c1
Sequence:CCGGTGGCATGACCAGTCTGCATAACTCGAGTTATGCAGACTGGTCATGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026241.1-433s1c1
Sequence:CCGGAGAAGGGTCACGAGGACATTTCTCGAGAAATGTCCTCGTGACCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)