EMAIL THIS PAGE TO A FRIEND

ANP32A

acidic (leucine-rich) nuclear phosphoprotein 32 family, member A

77 Gene Product Result for
Synonyms: C15orf1 HPPCn I1PP2A LANP MAPM PHAP1 PHAPI PP32
UniProtKB ID: P39687, B2R6T4, Q53FK4, Q5J8L8, Q7M4N6
Gene ID:
Mouse(11737) acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
Rat(25379) acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
naked mole-rat(101704380) acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
domestic guinea pig(100730980) acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
sheep(101105917) acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
Zebrafish(335907) acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
cow(538427) acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
domestic cat(101099468) acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
chicken(415562) acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
dog(403534) acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40203 Anti-ANP32A (AB1) antibody produced in rabbit affinity isolated antibody rat, horse, canine, bovine, guinea pig, zebrafish, human, rabbit, sheep, mouse,
immunohistochemistry, western blot pricing
AV40204 Anti-ANP32A (AB2) antibody produced in rabbit IgG fraction of antiserum guinea pig, rat, rabbit, horse, sheep, human, mouse, bovine, zebrafish, canine
immunohistochemistry, western blot pricing
HPA063133 Anti-ANP32A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA067561 Anti-ANP32A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3500397 Anti-PHAP I antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
WH0008125M1 Monoclonal Anti-ANP32A antibody produced in mouse clone 2G11-4A5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300343 Monoclonal Anti-ANP32A antibody produced in mouse clone 8D2, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0382 AQUA Peptide IEGLTDETY[R] mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009672 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009672 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009672 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006305 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006305 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006305 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147361 MISSION® esiRNA esiRNA human ANP32A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006305 Rosetta Predictions human pricing
NM_012903 Rosetta Predictions rat pricing
NM_009672 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156652 predicted 294
2 SASI_Hs01_00156653 predicted 293
3 SASI_Hs01_00156654 predicted 290
4 SASI_Hs01_00156656 predicted 905
5 SASI_Hs02_00341322 predicted 870
6 SASI_Hs02_00341323 predicted 908
7 SASI_Hs02_00341324 predicted 874
8 SASI_Hs01_00156647 predicted 307
9 SASI_Hs01_00156648 predicted 401
10 SASI_Hs01_00156649 predicted 398
11 SASI_Hs01_00156650 predicted 332
12 SASI_Hs01_00156651 predicted 335
13 SASI_Hs01_00156655 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012903 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260431 predicted 265
2 SASI_Rn02_00260432 predicted 255
3 SASI_Rn01_00053412 predicted 245
4 SASI_Rn01_00053413 predicted 412
5 SASI_Rn02_00260433 predicted 201
6 SASI_Rn02_00260434 predicted 401
7 SASI_Rn02_00260435 predicted 416
8 SASI_Rn02_00260436 predicted 398
9 SASI_Rn02_00260437 predicted 335
10 SASI_Rn02_00260438 predicted 340
11 SASI_Rn01_00053407 predicted 355
12 SASI_Rn01_00053408 predicted 297
13 SASI_Rn01_00053409 predicted 354
14 SASI_Rn01_00053410 predicted 358
15 SASI_Rn01_00053411 predicted 365
16 SASI_Rn01_00053414 predicted 221
17 SASI_Rn01_00053415 predicted 223
18 SASI_Rn01_00053416 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182330 predicted 1295
2 SASI_Mm02_00316712 predicted 467
3 SASI_Mm02_00316713 predicted 920
4 SASI_Mm02_00316714 predicted 511
5 SASI_Mm02_00316715 predicted 596
6 SASI_Mm02_00316716 predicted 889
7 SASI_Mm02_00316717 predicted 998
8 SASI_Mm02_00316718 predicted 1184
9 SASI_Mm02_00316719 predicted 1008
10 SASI_Mm02_00316720 predicted 575
11 SASI_Mm01_00182331 predicted 400
12 SASI_Mm01_00182332 predicted 271
13 SASI_Mm01_00182333 predicted 348
14 SASI_Mm01_00182334 predicted 1190
15 SASI_Mm01_00182335 predicted 338
16 SASI_Mm01_00182336 predicted 399
17 SASI_Mm01_00182337 predicted 209
18 SASI_Mm01_00182338 predicted 232
19 SASI_Mm01_00182339 predicted 272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009672
VALIDATED
ANP32A MISSION shRNA Bacterial Glycerol Stock
acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009672.2-1287s1c1
Sequence:CCGGCCGGTTTGTAAATAGCAACCACTCGAGTGGTTGCTATTTACAAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009672.2-346s1c1
Sequence:CCGGGCATCTAAATTTAAGTGGCAACTCGAGTTGCCACTTAAATTTAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009672.2-692s1c1
Sequence:CCGGGAGGATGAGGAAGGTTACAATCTCGAGATTGTAACCTTCCTCATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009672.2-310s1c1
Sequence:CCGGCCTGGAAGTATTGGCAGAGAACTCGAGTTCTCTGCCAATACTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009672.3-228s21c1
Sequence:CCGGCTGGATAACTGTAAGTCAATTCTCGAGAATTGACTTACAGTTATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009672.2-497s1c2
Sequence:CCGGGTCATGTACCTCGATGGCTATCTCGAGATAGCCATCGAGGTACATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009672.3-777s21c1
Sequence:CCGGGAGGATGAGGAAGGTTACAATCTCGAGATTGTAACCTTCCTCATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009672.3-395s21c1
Sequence:CCGGCCTGGAAGTATTGGCAGAGAACTCGAGTTCTCTGCCAATACTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009672.3-1212s21c1
Sequence:CCGGTGGCTTGGAGGTCTAACATTTCTCGAGAAATGTTAGACCTCCAAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009672.3-353s21c1
Sequence:CCGGACTCAAGAAGCTTGAATTAAGCTCGAGCTTAATTCAAGCTTCTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009672
VALIDATED
ANP32A MISSION shRNA shRNA Plasmid DNA
acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009672.2-1287s1c1
Sequence:CCGGCCGGTTTGTAAATAGCAACCACTCGAGTGGTTGCTATTTACAAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009672.2-346s1c1
Sequence:CCGGGCATCTAAATTTAAGTGGCAACTCGAGTTGCCACTTAAATTTAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009672.2-692s1c1
Sequence:CCGGGAGGATGAGGAAGGTTACAATCTCGAGATTGTAACCTTCCTCATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009672.2-310s1c1
Sequence:CCGGCCTGGAAGTATTGGCAGAGAACTCGAGTTCTCTGCCAATACTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009672.3-228s21c1
Sequence:CCGGCTGGATAACTGTAAGTCAATTCTCGAGAATTGACTTACAGTTATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009672.2-497s1c2
Sequence:CCGGGTCATGTACCTCGATGGCTATCTCGAGATAGCCATCGAGGTACATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009672.3-777s21c1
Sequence:CCGGGAGGATGAGGAAGGTTACAATCTCGAGATTGTAACCTTCCTCATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009672.3-395s21c1
Sequence:CCGGCCTGGAAGTATTGGCAGAGAACTCGAGTTCTCTGCCAATACTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009672.3-1212s21c1
Sequence:CCGGTGGCTTGGAGGTCTAACATTTCTCGAGAAATGTTAGACCTCCAAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009672.3-353s21c1
Sequence:CCGGACTCAAGAAGCTTGAATTAAGCTCGAGCTTAATTCAAGCTTCTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009672
VALIDATED
ANP32A MISSION shRNA Lentiviral Transduction Particles
acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009672.2-1287s1c1
Sequence:CCGGCCGGTTTGTAAATAGCAACCACTCGAGTGGTTGCTATTTACAAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009672.2-346s1c1
Sequence:CCGGGCATCTAAATTTAAGTGGCAACTCGAGTTGCCACTTAAATTTAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009672.2-692s1c1
Sequence:CCGGGAGGATGAGGAAGGTTACAATCTCGAGATTGTAACCTTCCTCATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009672.2-310s1c1
Sequence:CCGGCCTGGAAGTATTGGCAGAGAACTCGAGTTCTCTGCCAATACTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009672.3-228s21c1
Sequence:CCGGCTGGATAACTGTAAGTCAATTCTCGAGAATTGACTTACAGTTATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009672.2-497s1c2
Sequence:CCGGGTCATGTACCTCGATGGCTATCTCGAGATAGCCATCGAGGTACATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009672.3-777s21c1
Sequence:CCGGGAGGATGAGGAAGGTTACAATCTCGAGATTGTAACCTTCCTCATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009672.3-395s21c1
Sequence:CCGGCCTGGAAGTATTGGCAGAGAACTCGAGTTCTCTGCCAATACTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009672.3-1212s21c1
Sequence:CCGGTGGCTTGGAGGTCTAACATTTCTCGAGAAATGTTAGACCTCCAAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009672.3-353s21c1
Sequence:CCGGACTCAAGAAGCTTGAATTAAGCTCGAGCTTAATTCAAGCTTCTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006305
VALIDATED
ANP32A MISSION shRNA Bacterial Glycerol Stock
acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006305.2-854s1c1
Sequence:CCGGCCTGAAGATGAGGGAGAAGATCTCGAGATCTTCTCCCTCATCTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006902    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006305.2-909s1c1
Sequence:CCGGCCTATTGTGATTTGACTGTTTCTCGAGAAACAGTCAAATCACAATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006305.2-333s1c1
Sequence:CCGGAGAAGCTTGAACTAAGCGATACTCGAGTATCGCTTAGTTCAAGCTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006305.2-179s1c1
Sequence:CCGGCCCTCTGATGTGAAAGAACTTCTCGAGAAGTTCTTTCACATCAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006305.2-369s1c1
Sequence:CCGGGCCTGGAAGTATTGGCAGAAACTCGAGTTTCTGCCAATACTTCCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006305.2-179s21c1
Sequence:CCGGCCCTCTGATGTGAAAGAACTTCTCGAGAAGTTCTTTCACATCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006305.2-854s21c1
Sequence:CCGGCCTGAAGATGAGGGAGAAGATCTCGAGATCTTCTCCCTCATCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006305.2-369s21c1
Sequence:CCGGGCCTGGAAGTATTGGCAGAAACTCGAGTTTCTGCCAATACTTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006305.2-909s21c1
Sequence:CCGGCCTATTGTGATTTGACTGTTTCTCGAGAAACAGTCAAATCACAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006305
VALIDATED
ANP32A MISSION shRNA shRNA Plasmid DNA
acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006305.2-854s1c1
Sequence:CCGGCCTGAAGATGAGGGAGAAGATCTCGAGATCTTCTCCCTCATCTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006902    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006305.2-909s1c1
Sequence:CCGGCCTATTGTGATTTGACTGTTTCTCGAGAAACAGTCAAATCACAATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006305.2-333s1c1
Sequence:CCGGAGAAGCTTGAACTAAGCGATACTCGAGTATCGCTTAGTTCAAGCTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006305.2-179s1c1
Sequence:CCGGCCCTCTGATGTGAAAGAACTTCTCGAGAAGTTCTTTCACATCAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006305.2-369s1c1
Sequence:CCGGGCCTGGAAGTATTGGCAGAAACTCGAGTTTCTGCCAATACTTCCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006305.2-179s21c1
Sequence:CCGGCCCTCTGATGTGAAAGAACTTCTCGAGAAGTTCTTTCACATCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006305.2-854s21c1
Sequence:CCGGCCTGAAGATGAGGGAGAAGATCTCGAGATCTTCTCCCTCATCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006305.2-369s21c1
Sequence:CCGGGCCTGGAAGTATTGGCAGAAACTCGAGTTTCTGCCAATACTTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006305.2-909s21c1
Sequence:CCGGCCTATTGTGATTTGACTGTTTCTCGAGAAACAGTCAAATCACAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006305
VALIDATED
ANP32A MISSION shRNA Lentiviral Transduction Particles
acidic (leucine-rich) nuclear phosphoprotein 32 family, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006305.2-854s1c1
Sequence:CCGGCCTGAAGATGAGGGAGAAGATCTCGAGATCTTCTCCCTCATCTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006902    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006305.2-909s1c1
Sequence:CCGGCCTATTGTGATTTGACTGTTTCTCGAGAAACAGTCAAATCACAATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006305.2-333s1c1
Sequence:CCGGAGAAGCTTGAACTAAGCGATACTCGAGTATCGCTTAGTTCAAGCTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006305.2-179s1c1
Sequence:CCGGCCCTCTGATGTGAAAGAACTTCTCGAGAAGTTCTTTCACATCAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006305.2-369s1c1
Sequence:CCGGGCCTGGAAGTATTGGCAGAAACTCGAGTTTCTGCCAATACTTCCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006305.2-179s21c1
Sequence:CCGGCCCTCTGATGTGAAAGAACTTCTCGAGAAGTTCTTTCACATCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006305.2-854s21c1
Sequence:CCGGCCTGAAGATGAGGGAGAAGATCTCGAGATCTTCTCCCTCATCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006305.2-369s21c1
Sequence:CCGGGCCTGGAAGTATTGGCAGAAACTCGAGTTTCTGCCAATACTTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006305.2-909s21c1
Sequence:CCGGCCTATTGTGATTTGACTGTTTCTCGAGAAACAGTCAAATCACAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)