EMAIL THIS PAGE TO A FRIEND

ANXA5

annexin A5

101 Gene Product Result for
Synonyms: ANX5 ENX2 PP4 RPRGL3
UniProtKB ID: P08758, D3DNW7, Q6FHB3, Q6FI16, Q8WV69, Q9UDH9
Gene ID:
Human(308) Summary: The protein encoded by this gene belongs to the annexin family of calcium-dependent phospholipid binding proteins some of which have been implicated in membrane-related events along exocytotic and endocytotic pathways. Annexin 5 is a phospholipase A2 and protein kinase C inhibitory protein with calcium channel activity and a potential role in cellular signal transduction, inflammation, growth and differentiation. Annexin 5 has also been described as placental anticoagulant protein I, vascular anticoagulant-alpha, endonexin II, lipocortin V, placental protein 4 and anchorin CII. The gene spans 29 kb containing 13 exons, and encodes a single transcript of approximately 1.6 kb and a protein product with a molecular weight of about 35 kDa. [provided by RefSeq, Jul 2008]
Mouse(11747) annexin A5
Rat(25673) annexin A5
sheep(101114445) annexin A5
chicken(428767) annexin A5
cow(281626) annexin A5
dog(476094) annexin A5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306341 ANTI-ANNEXIN V(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306510 ANTI-ANNEXIN V(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
AV36573 Anti-ANXA5 (AB1) antibody produced in rabbit IgG fraction of antiserum rabbit, mouse, canine, rat, guinea pig, human, bovine, horse, rabbit
western blot pricing
AV36687 Anti-ANXA5 (AB2) antibody produced in rabbit IgG fraction of antiserum rabbit, sheep, mouse, guinea pig, bovine, canine, human, rat, horse
western blot pricing
SAB1405460 Anti-ANXA5 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA035330 Anti-ANXA5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1410621 Anti-ANXA5 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, western blot pricing
A8604 Monoclonal Anti-Annexin V antibody produced in mouse clone AN5, purified from hybridoma cell culture human
ELISA, immunocytochemistry, microarray, western blot pricing
WH0000308M1 Monoclonal Anti-ANXA5 antibody produced in mouse clone 1F4-1A5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0810 AQUA Peptide GLGTDEESILTLLTS[R] human pricing
AQ0809 AQUA Peptide GTVTDFPGFDE[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001154 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001154 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001154 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001154 Rosetta Predictions human pricing
NM_013132 Rosetta Predictions rat pricing
NM_009673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218150 predicted 986
2 SASI_Hs01_00218151 predicted 861
3 SASI_Hs01_00218152 predicted 886
4 SASI_Hs01_00218153 predicted 873
5 SASI_Hs02_00331261 predicted 457
6 SASI_Hs01_00218155 predicted 494
7 SASI_Hs01_00218156 predicted 1223
8 SASI_Hs02_00331262 predicted 228
9 SASI_Hs02_00331263 predicted 994
10 SASI_Hs02_00331264 predicted 950
11 SASI_Hs01_00218149 predicted 812
12 SASI_Hs01_00218154 predicted 530
13 SASI_Hs01_00218157 predicted 565
14 SASI_Hs01_00218158 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074516 predicted 884
2 SASI_Rn01_00074519 predicted 277
3 SASI_Rn01_00074520 predicted 792
4 SASI_Rn02_00260926 predicted 376
5 SASI_Rn01_00074521 predicted 891
6 SASI_Rn01_00074522 predicted 962
7 SASI_Rn01_00074523 predicted 258
8 SASI_Rn02_00260927 predicted 505
9 SASI_Rn01_00074525 predicted 781
10 SASI_Rn02_00260928 predicted 708
11 SASI_Rn01_00074517 predicted 683
12 SASI_Rn01_00074518 predicted 694
13 SASI_Rn01_00074524 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044536 predicted 626
2 SASI_Mm01_00044537 predicted 299
3 SASI_Mm01_00044538 predicted 472
4 SASI_Mm01_00044539 predicted 972
5 SASI_Mm01_00044540 predicted 264
6 SASI_Mm01_00044541 predicted 873
7 SASI_Mm01_00044542 predicted 1051
8 SASI_Mm02_00316721 predicted 362
9 SASI_Mm01_00044543 predicted 865
10 SASI_Mm01_00044544 predicted 792
11 SASI_Mm01_00044545 predicted 280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009673
VALIDATED
ANXA5 MISSION shRNA Bacterial Glycerol Stock
annexin A5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009673.1-1254s1c1
Sequence:CCGGGCCCTTCTGATGTTCTGTCTACTCGAGTAGACAGAACATCAGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009673.1-868s1c1
Sequence:CCGGCGTGAAGTCTATTCGGAGCATCTCGAGATGCTCCGAATAGACTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009673.1-750s1c1
Sequence:CCGGGCAGTGTGTCTCATTTAAGAACTCGAGTTCTTAAATGAGACACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009673.1-467s1c1
Sequence:CCGGGAGAAAGTATTGACCGAGATTCTCGAGAATCTCGGTCAATACTTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009673.1-466s1c1
Sequence:CCGGCGAGAAAGTATTGACCGAGATCTCGAGATCTCGGTCAATACTTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009673.2-1057s21c1
Sequence:CCGGCGTGAAGTCTATTCGGAGCATCTCGAGATGCTCCGAATAGACTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009673.2-939s21c1
Sequence:CCGGGCAGTGTGTCTCATTTAAGAACTCGAGTTCTTAAATGAGACACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009673.2-1443s21c1
Sequence:CCGGGCCCTTCTGATGTTCTGTCTACTCGAGTAGACAGAACATCAGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009673.2-655s21c1
Sequence:CCGGCGAGAAAGTATTGACCGAGATCTCGAGATCTCGGTCAATACTTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009673
VALIDATED
ANXA5 MISSION shRNA shRNA Plasmid DNA
annexin A5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009673.1-1254s1c1
Sequence:CCGGGCCCTTCTGATGTTCTGTCTACTCGAGTAGACAGAACATCAGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009673.1-868s1c1
Sequence:CCGGCGTGAAGTCTATTCGGAGCATCTCGAGATGCTCCGAATAGACTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009673.1-750s1c1
Sequence:CCGGGCAGTGTGTCTCATTTAAGAACTCGAGTTCTTAAATGAGACACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009673.1-467s1c1
Sequence:CCGGGAGAAAGTATTGACCGAGATTCTCGAGAATCTCGGTCAATACTTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009673.1-466s1c1
Sequence:CCGGCGAGAAAGTATTGACCGAGATCTCGAGATCTCGGTCAATACTTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009673.2-1057s21c1
Sequence:CCGGCGTGAAGTCTATTCGGAGCATCTCGAGATGCTCCGAATAGACTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009673.2-939s21c1
Sequence:CCGGGCAGTGTGTCTCATTTAAGAACTCGAGTTCTTAAATGAGACACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009673.2-1443s21c1
Sequence:CCGGGCCCTTCTGATGTTCTGTCTACTCGAGTAGACAGAACATCAGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009673.2-655s21c1
Sequence:CCGGCGAGAAAGTATTGACCGAGATCTCGAGATCTCGGTCAATACTTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009673
VALIDATED
ANXA5 MISSION shRNA Lentiviral Transduction Particles
annexin A5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009673.1-1254s1c1
Sequence:CCGGGCCCTTCTGATGTTCTGTCTACTCGAGTAGACAGAACATCAGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009673.1-868s1c1
Sequence:CCGGCGTGAAGTCTATTCGGAGCATCTCGAGATGCTCCGAATAGACTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009673.1-750s1c1
Sequence:CCGGGCAGTGTGTCTCATTTAAGAACTCGAGTTCTTAAATGAGACACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009673.1-467s1c1
Sequence:CCGGGAGAAAGTATTGACCGAGATTCTCGAGAATCTCGGTCAATACTTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009673.1-466s1c1
Sequence:CCGGCGAGAAAGTATTGACCGAGATCTCGAGATCTCGGTCAATACTTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009673.2-1057s21c1
Sequence:CCGGCGTGAAGTCTATTCGGAGCATCTCGAGATGCTCCGAATAGACTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009673.2-939s21c1
Sequence:CCGGGCAGTGTGTCTCATTTAAGAACTCGAGTTCTTAAATGAGACACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009673.2-1443s21c1
Sequence:CCGGGCCCTTCTGATGTTCTGTCTACTCGAGTAGACAGAACATCAGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009673.2-655s21c1
Sequence:CCGGCGAGAAAGTATTGACCGAGATCTCGAGATCTCGGTCAATACTTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001154
VALIDATED
ANXA5 MISSION shRNA Bacterial Glycerol Stock
annexin A5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001154.2-562s1c1
Sequence:CCGGGCCATCAAACAAGTTTATGAACTCGAGTTCATAAACTTGTTTGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001154.2-1085s1c1
Sequence:CCGGCCATGATTAAGGGAGATACATCTCGAGATGTATCTCCCTTAATCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001154.2-685s1c1
Sequence:CCGGGCTGGAATTGATGAAGCTCAACTCGAGTTGAGCTTCATCAATTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001154.2-302s1c1
Sequence:CCGGGCATCCTGACTCTGTTGACATCTCGAGATGTCAACAGAGTCAGGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001154.2-871s1c1
Sequence:CCGGCGCGAGACTTCTGGCAATTTACTCGAGTAAATTGCCAGAAGTCTCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001154.3-844s21c1
Sequence:CCGGCGCGAGACTTCTGGCAATTTACTCGAGTAAATTGCCAGAAGTCTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001154.3-535s21c1
Sequence:CCGGGCCATCAAACAAGTTTATGAACTCGAGTTCATAAACTTGTTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001154.3-275s21c1
Sequence:CCGGGCATCCTGACTCTGTTGACATCTCGAGATGTCAACAGAGTCAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001154.3-658s21c1
Sequence:CCGGGCTGGAATTGATGAAGCTCAACTCGAGTTGAGCTTCATCAATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001154
VALIDATED
ANXA5 MISSION shRNA shRNA Plasmid DNA
annexin A5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001154.2-562s1c1
Sequence:CCGGGCCATCAAACAAGTTTATGAACTCGAGTTCATAAACTTGTTTGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001154.2-1085s1c1
Sequence:CCGGCCATGATTAAGGGAGATACATCTCGAGATGTATCTCCCTTAATCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001154.2-685s1c1
Sequence:CCGGGCTGGAATTGATGAAGCTCAACTCGAGTTGAGCTTCATCAATTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001154.2-302s1c1
Sequence:CCGGGCATCCTGACTCTGTTGACATCTCGAGATGTCAACAGAGTCAGGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001154.2-871s1c1
Sequence:CCGGCGCGAGACTTCTGGCAATTTACTCGAGTAAATTGCCAGAAGTCTCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001154.3-844s21c1
Sequence:CCGGCGCGAGACTTCTGGCAATTTACTCGAGTAAATTGCCAGAAGTCTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001154.3-535s21c1
Sequence:CCGGGCCATCAAACAAGTTTATGAACTCGAGTTCATAAACTTGTTTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001154.3-275s21c1
Sequence:CCGGGCATCCTGACTCTGTTGACATCTCGAGATGTCAACAGAGTCAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001154.3-658s21c1
Sequence:CCGGGCTGGAATTGATGAAGCTCAACTCGAGTTGAGCTTCATCAATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001154
VALIDATED
ANXA5 MISSION shRNA Lentiviral Transduction Particles
annexin A5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001154.2-562s1c1
Sequence:CCGGGCCATCAAACAAGTTTATGAACTCGAGTTCATAAACTTGTTTGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001154.2-1085s1c1
Sequence:CCGGCCATGATTAAGGGAGATACATCTCGAGATGTATCTCCCTTAATCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001154.2-685s1c1
Sequence:CCGGGCTGGAATTGATGAAGCTCAACTCGAGTTGAGCTTCATCAATTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001154.2-302s1c1
Sequence:CCGGGCATCCTGACTCTGTTGACATCTCGAGATGTCAACAGAGTCAGGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001154.2-871s1c1
Sequence:CCGGCGCGAGACTTCTGGCAATTTACTCGAGTAAATTGCCAGAAGTCTCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001154.3-844s21c1
Sequence:CCGGCGCGAGACTTCTGGCAATTTACTCGAGTAAATTGCCAGAAGTCTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001154.3-535s21c1
Sequence:CCGGGCCATCAAACAAGTTTATGAACTCGAGTTCATAAACTTGTTTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001154.3-275s21c1
Sequence:CCGGGCATCCTGACTCTGTTGACATCTCGAGATGTCAACAGAGTCAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001154.3-658s21c1
Sequence:CCGGGCTGGAATTGATGAAGCTCAACTCGAGTTGAGCTTCATCAATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)