EMAIL THIS PAGE TO A FRIEND

APLP1

amyloid beta (A4) precursor-like protein 1

86 Gene Product Result for
Synonyms: APLP
UniProtKB ID: P51693, O00113, Q96A92
Gene ID:
Human(333) Summary: This gene encodes a member of the highly conserved amyloid precursor protein gene family. The encoded protein is a membrane-associated glycoprotein that is cleaved by secretases in a manner similar to amyloid beta A4 precursor protein cleavage. This cleavage liberates an intracellular cytoplasmic fragment that may act as a transcriptional activator. The encoded protein may also play a role in synaptic maturation during cortical development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(11803) amyloid beta (A4) precursor-like protein 1
Rat(502317) amyloid beta (A4) precursor-like protein 1
Zebrafish(404233) amyloid beta (A4) precursor-like protein 1
dog(476478) amyloid beta (A4) precursor-like protein 1
Horse(100060016) amyloid beta (A4) precursor-like protein 1
cow(513154) amyloid beta (A4) precursor-like protein 1
domestic cat(101097529) amyloid beta (A4) precursor-like protein 1
sheep(101105352) amyloid beta (A4) precursor-like protein 1
domestic guinea pig(100725457) amyloid beta (A4) precursor-like protein 1
naked mole-rat(101706550) amyloid beta (A4) precursor-like protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007467 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007467 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007467 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005166 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024807 Rosetta Predictions human pricing
NM_005166 Rosetta Predictions human pricing
NM_001100802 Rosetta Predictions rat pricing
NM_007467 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022324 predicted 967
2 SASI_Hs01_00022325 predicted 1092
3 SASI_Hs01_00022326 predicted 623
4 SASI_Hs01_00022327 predicted 1266
5 SASI_Hs01_00022328 predicted 1092
6 SASI_Hs02_00307246 predicted 998
7 SASI_Hs02_00307247 predicted 998
8 SASI_Hs02_00307248 predicted 1122
9 SASI_Hs01_00022329 predicted 2180
10 SASI_Hs01_00022330 predicted 2025
11 SASI_Hs01_00022322 predicted 1122
12 SASI_Hs01_00022323 predicted 1187
13 SASI_Hs01_00022331 predicted 2196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085928 predicted 958
2 SASI_Hs01_00085929 predicted 1088
3 SASI_Hs01_00085930 predicted 627
4 SASI_Hs01_00085931 predicted 1273
5 SASI_Hs01_00085932 predicted 1094
6 SASI_Hs02_00339108 predicted 1005
7 SASI_Hs02_00339109 predicted 1002
8 SASI_Hs02_00339110 predicted 1123
9 SASI_Hs01_00085933 predicted 2177
10 SASI_Hs01_00085934 predicted 2024
11 SASI_Hs01_00085926 predicted 1126
12 SASI_Hs01_00085927 predicted 1185
13 SASI_Hs01_00085935 predicted 2185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210582 predicted 1015
2 SASI_Rn02_00210583 predicted 1194
3 SASI_Rn02_00210584 predicted 1922
4 SASI_Rn02_00210585 predicted 1017
5 SASI_Rn02_00210586 predicted 1715
6 SASI_Rn02_00210587 predicted 1389
7 SASI_Rn02_00210588 predicted 519
8 SASI_Rn02_00210589 predicted 1071
9 SASI_Rn02_00210590 predicted 1417
10 SASI_Rn02_00210591 predicted 1838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007467 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050223 predicted 970
2 SASI_Mm01_00050225 predicted 1054
3 SASI_Mm01_00050226 predicted 1090
4 SASI_Mm02_00311678 predicted 936
5 SASI_Mm01_00050227 predicted 1240
6 SASI_Mm01_00050228 predicted 1996
7 SASI_Mm01_00050229 predicted 264
8 SASI_Mm01_00050230 predicted 1791
9 SASI_Mm02_00311679 predicted 826
10 SASI_Mm01_00050231 predicted 274
11 SASI_Mm01_00050224 predicted 2140
12 SASI_Mm01_00050232 predicted 1296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007467
APLP1 MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor-like protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007467.1-2171s1c1
Sequence:CCGGGTTCCAAATTCCACACCCTTACTCGAGTAAGGGTGTGGAATTTGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007467.1-965s1c1
Sequence:CCGGCTACTGATGGTGTGGATGTTTCTCGAGAAACATCCACACCATCAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007467.1-838s1c1
Sequence:CCGGCCAGTAGACGATTACTTCGTACTCGAGTACGAAGTAATCGTCTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007467.1-1459s1c1
Sequence:CCGGGTGATCGAAGAGCGAATGAATCTCGAGATTCATTCGCTCTTCGATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007467.1-1903s1c1
Sequence:CCGGCTGCGCAAGAAGAAACCCTATCTCGAGATAGGGTTTCTTCTTGCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007467.2-847s21c1
Sequence:CCGGCCAGTAGACGATTACTTCGTACTCGAGTACGAAGTAATCGTCTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007467.2-2139s21c1
Sequence:CCGGGAGGGAGATCTTGACAAATTCCTCGAGGAATTTGTCAAGATCTCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007467.2-1063s21c1
Sequence:CCGGCGTAGGATGCGCCAGATTAATCTCGAGATTAATCTGGCGCATCCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007467.2-264s21c1
Sequence:CCGGTGGACTATGTGGGCGTCTAACCTCGAGGTTAGACGCCCACATAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007467.2-1468s21c1
Sequence:CCGGGTGATCGAAGAGCGAATGAATCTCGAGATTCATTCGCTCTTCGATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007467
APLP1 MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor-like protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007467.1-2171s1c1
Sequence:CCGGGTTCCAAATTCCACACCCTTACTCGAGTAAGGGTGTGGAATTTGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007467.1-965s1c1
Sequence:CCGGCTACTGATGGTGTGGATGTTTCTCGAGAAACATCCACACCATCAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007467.1-838s1c1
Sequence:CCGGCCAGTAGACGATTACTTCGTACTCGAGTACGAAGTAATCGTCTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007467.1-1459s1c1
Sequence:CCGGGTGATCGAAGAGCGAATGAATCTCGAGATTCATTCGCTCTTCGATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007467.1-1903s1c1
Sequence:CCGGCTGCGCAAGAAGAAACCCTATCTCGAGATAGGGTTTCTTCTTGCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007467.2-847s21c1
Sequence:CCGGCCAGTAGACGATTACTTCGTACTCGAGTACGAAGTAATCGTCTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007467.2-2139s21c1
Sequence:CCGGGAGGGAGATCTTGACAAATTCCTCGAGGAATTTGTCAAGATCTCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007467.2-1063s21c1
Sequence:CCGGCGTAGGATGCGCCAGATTAATCTCGAGATTAATCTGGCGCATCCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007467.2-264s21c1
Sequence:CCGGTGGACTATGTGGGCGTCTAACCTCGAGGTTAGACGCCCACATAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007467.2-1468s21c1
Sequence:CCGGGTGATCGAAGAGCGAATGAATCTCGAGATTCATTCGCTCTTCGATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007467
APLP1 MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor-like protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007467.1-2171s1c1
Sequence:CCGGGTTCCAAATTCCACACCCTTACTCGAGTAAGGGTGTGGAATTTGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007467.1-965s1c1
Sequence:CCGGCTACTGATGGTGTGGATGTTTCTCGAGAAACATCCACACCATCAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007467.1-838s1c1
Sequence:CCGGCCAGTAGACGATTACTTCGTACTCGAGTACGAAGTAATCGTCTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007467.1-1459s1c1
Sequence:CCGGGTGATCGAAGAGCGAATGAATCTCGAGATTCATTCGCTCTTCGATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007467.1-1903s1c1
Sequence:CCGGCTGCGCAAGAAGAAACCCTATCTCGAGATAGGGTTTCTTCTTGCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007467.2-847s21c1
Sequence:CCGGCCAGTAGACGATTACTTCGTACTCGAGTACGAAGTAATCGTCTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007467.2-2139s21c1
Sequence:CCGGGAGGGAGATCTTGACAAATTCCTCGAGGAATTTGTCAAGATCTCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007467.2-1063s21c1
Sequence:CCGGCGTAGGATGCGCCAGATTAATCTCGAGATTAATCTGGCGCATCCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007467.2-264s21c1
Sequence:CCGGTGGACTATGTGGGCGTCTAACCTCGAGGTTAGACGCCCACATAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007467.2-1468s21c1
Sequence:CCGGGTGATCGAAGAGCGAATGAATCTCGAGATTCATTCGCTCTTCGATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005166
VALIDATED
APLP1 MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor-like protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005166.2-1711s1c1
Sequence:CCGGCGAAAGGTGAATGCGTCTGTTCTCGAGAACAGACGCATTCACCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005166.2-1035s1c1
Sequence:CCGGGCGCCAGATTAATGAGGTGATCTCGAGATCACCTCATTAATCTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005166.2-557s1c1
Sequence:CCGGGCATGGACCAATGTGAGAGTTCTCGAGAACTCTCACATTGGTCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005166.2-492s1c1
Sequence:CCGGGCCTGGTGAATTTGTGAGTGACTCGAGTCACTCACAAATTCACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005166.3-1780s21c1
Sequence:CCGGCGAAAGGTGAATGCGTCTGTTCTCGAGAACAGACGCATTCACCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005166.3-1764s21c1
Sequence:CCGGGCTGGAACAGTATGAGCGAAACTCGAGTTTCGCTCATACTGTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005166.3-626s21c1
Sequence:CCGGGCATGGACCAATGTGAGAGTTCTCGAGAACTCTCACATTGGTCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005166.3-1104s21c1
Sequence:CCGGGCGCCAGATTAATGAGGTGATCTCGAGATCACCTCATTAATCTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005166.3-561s21c1
Sequence:CCGGGCCTGGTGAATTTGTGAGTGACTCGAGTCACTCACAAATTCACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005166
VALIDATED
APLP1 MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor-like protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005166.2-1711s1c1
Sequence:CCGGCGAAAGGTGAATGCGTCTGTTCTCGAGAACAGACGCATTCACCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005166.2-1035s1c1
Sequence:CCGGGCGCCAGATTAATGAGGTGATCTCGAGATCACCTCATTAATCTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005166.2-557s1c1
Sequence:CCGGGCATGGACCAATGTGAGAGTTCTCGAGAACTCTCACATTGGTCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005166.2-492s1c1
Sequence:CCGGGCCTGGTGAATTTGTGAGTGACTCGAGTCACTCACAAATTCACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005166.3-1780s21c1
Sequence:CCGGCGAAAGGTGAATGCGTCTGTTCTCGAGAACAGACGCATTCACCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005166.3-1764s21c1
Sequence:CCGGGCTGGAACAGTATGAGCGAAACTCGAGTTTCGCTCATACTGTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005166.3-626s21c1
Sequence:CCGGGCATGGACCAATGTGAGAGTTCTCGAGAACTCTCACATTGGTCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005166.3-1104s21c1
Sequence:CCGGGCGCCAGATTAATGAGGTGATCTCGAGATCACCTCATTAATCTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005166.3-561s21c1
Sequence:CCGGGCCTGGTGAATTTGTGAGTGACTCGAGTCACTCACAAATTCACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005166
VALIDATED
APLP1 MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor-like protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005166.2-1711s1c1
Sequence:CCGGCGAAAGGTGAATGCGTCTGTTCTCGAGAACAGACGCATTCACCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005166.2-1035s1c1
Sequence:CCGGGCGCCAGATTAATGAGGTGATCTCGAGATCACCTCATTAATCTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005166.2-557s1c1
Sequence:CCGGGCATGGACCAATGTGAGAGTTCTCGAGAACTCTCACATTGGTCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005166.2-492s1c1
Sequence:CCGGGCCTGGTGAATTTGTGAGTGACTCGAGTCACTCACAAATTCACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005166.3-1780s21c1
Sequence:CCGGCGAAAGGTGAATGCGTCTGTTCTCGAGAACAGACGCATTCACCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005166.3-1764s21c1
Sequence:CCGGGCTGGAACAGTATGAGCGAAACTCGAGTTTCGCTCATACTGTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005166.3-626s21c1
Sequence:CCGGGCATGGACCAATGTGAGAGTTCTCGAGAACTCTCACATTGGTCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005166.3-1104s21c1
Sequence:CCGGGCGCCAGATTAATGAGGTGATCTCGAGATCACCTCATTAATCTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005166.3-561s21c1
Sequence:CCGGGCCTGGTGAATTTGTGAGTGACTCGAGTCACTCACAAATTCACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)