EMAIL THIS PAGE TO A FRIEND

APMAP

adipocyte plasma membrane associated protein

68 Gene Product Result for
Synonyms: BSCv C20orf3
UniProtKB ID: Q9HDC9, A8K514, B4DXG1, Q6UVZ8, Q9GZS8, Q9NUB2
Gene ID:
Mouse(71881) adipocyte plasma membrane associated protein
Rat(366227) adipocyte plasma membrane associated protein
Zebrafish(266637) adipocyte plasma membrane associated protein
domestic cat(101090092) adipocyte plasma membrane associated protein
dog(608089) adipocyte plasma membrane associated protein
cow(535740) adipocyte plasma membrane associated protein
sheep(101104594) adipocyte plasma membrane associated protein
domestic guinea pig(100732137) adipocyte plasma membrane associated protein
naked mole-rat(101719169) adipocyte plasma membrane associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020531 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027977 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027977 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027977 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020531 Rosetta Predictions human pricing
NM_001034003 Rosetta Predictions rat pricing
NM_027977 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240032 predicted 423
2 SASI_Hs02_00353577 predicted 1336
3 SASI_Hs01_00240033 predicted 363
4 SASI_Hs02_00353578 predicted 223
5 SASI_Hs01_00240035 predicted 582
6 SASI_Hs01_00240036 predicted 762
7 SASI_Hs02_00353579 predicted 628
8 SASI_Hs01_00240038 predicted 724
9 SASI_Hs01_00240039 predicted 948
10 SASI_Hs01_00240040 predicted 599
11 SASI_Hs01_00240034 predicted 695
12 SASI_Hs01_00240037 predicted 1149
13 SASI_Hs01_00240041 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071214 predicted 793
2 SASI_Rn02_00203878 predicted 1123
3 SASI_Rn01_00071215 predicted 1032
4 SASI_Rn02_00203879 predicted 250
5 SASI_Rn01_00071217 predicted 1106
6 SASI_Rn01_00071218 predicted 204
7 SASI_Rn01_00071219 predicted 540
8 SASI_Rn01_00071220 predicted 580
9 SASI_Rn01_00071222 predicted 1294
10 SASI_Rn01_00071223 predicted 468
11 SASI_Rn01_00071216 predicted 1248
12 SASI_Rn01_00071221 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027977 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026987 predicted 326
2 SASI_Mm01_00026988 predicted 736
3 SASI_Mm01_00026989 predicted 915
4 SASI_Mm01_00026990 predicted 885
5 SASI_Mm01_00026991 predicted 629
6 SASI_Mm01_00026992 predicted 749
7 SASI_Mm01_00026993 predicted 373
8 SASI_Mm01_00026994 predicted 620
9 SASI_Mm01_00026995 predicted 335
10 SASI_Mm02_00333024 predicted 268
11 SASI_Mm01_00026996 predicted 1198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020531
VALIDATED
APMAP MISSION shRNA Bacterial Glycerol Stock
adipocyte plasma membrane associated protein
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020531.2-1762s21c1
Sequence:CCGGATATATAACGTGCGGTCATACCTCGAGGTATGACCGCACGTTATATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020531.2-1004s1c1
Sequence:CCGGGCCTGGATTTCCAGACAACATCTCGAGATGTTGTCTGGAAATCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020531.2-1145s1c1
Sequence:CCGGCTTTAGTCAAGAGACGGTGATCTCGAGATCACCGTCTCTTGACTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020531.2-336s21c1
Sequence:CCGGCTTGGTGTTCTGCATCCAAATCTCGAGATTTGGATGCAGAACACCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020531.2-758s1c1
Sequence:CCGGCAAATGGCAAAGACGAGACTACTCGAGTAGTCTCGTCTTTGCCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020531.2-1739s1c1
Sequence:CCGGCGGCCTCAAAGTTCTTCTTTACTCGAGTAAAGAAGAACTTTGAGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020531.2-1142s1c1
Sequence:CCGGGCTCTTTAGTCAAGAGACGGTCTCGAGACCGTCTCTTGACTAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020531.2-1107s21c1
Sequence:CCGGTCTGAGAGACCCTGGATTAAACTCGAGTTTAATCCAGGGTCTCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020531.2-830s21c1
Sequence:CCGGTACTGTGACCAGGGAAGTAAACTCGAGTTTACTTCCCTGGTCACAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020531.2-721s21c1
Sequence:CCGGAGGATGGGAGGAAGATTTATTCTCGAGAATAAATCTTCCTCCCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020531.2-1564s21c1
Sequence:CCGGTATCTGCCATGAGGAACATAACTCGAGTTATGTTCCTCATGGCAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020531.2-599s21c1
Sequence:CCGGCGATGCATACAAGGGACTATTCTCGAGAATAGTCCCTTGTATGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020531.2-404s21c1
Sequence:CCGGACCGGAGTCCATAGCACATATCTCGAGATATGTGCTATGGACTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020531
VALIDATED
APMAP MISSION shRNA shRNA Plasmid DNA
adipocyte plasma membrane associated protein
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020531.2-1762s21c1
Sequence:CCGGATATATAACGTGCGGTCATACCTCGAGGTATGACCGCACGTTATATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020531.2-1004s1c1
Sequence:CCGGGCCTGGATTTCCAGACAACATCTCGAGATGTTGTCTGGAAATCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020531.2-1145s1c1
Sequence:CCGGCTTTAGTCAAGAGACGGTGATCTCGAGATCACCGTCTCTTGACTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020531.2-336s21c1
Sequence:CCGGCTTGGTGTTCTGCATCCAAATCTCGAGATTTGGATGCAGAACACCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020531.2-758s1c1
Sequence:CCGGCAAATGGCAAAGACGAGACTACTCGAGTAGTCTCGTCTTTGCCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020531.2-1739s1c1
Sequence:CCGGCGGCCTCAAAGTTCTTCTTTACTCGAGTAAAGAAGAACTTTGAGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020531.2-1142s1c1
Sequence:CCGGGCTCTTTAGTCAAGAGACGGTCTCGAGACCGTCTCTTGACTAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020531.2-1107s21c1
Sequence:CCGGTCTGAGAGACCCTGGATTAAACTCGAGTTTAATCCAGGGTCTCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020531.2-830s21c1
Sequence:CCGGTACTGTGACCAGGGAAGTAAACTCGAGTTTACTTCCCTGGTCACAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020531.2-721s21c1
Sequence:CCGGAGGATGGGAGGAAGATTTATTCTCGAGAATAAATCTTCCTCCCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020531.2-1564s21c1
Sequence:CCGGTATCTGCCATGAGGAACATAACTCGAGTTATGTTCCTCATGGCAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020531.2-599s21c1
Sequence:CCGGCGATGCATACAAGGGACTATTCTCGAGAATAGTCCCTTGTATGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020531.2-404s21c1
Sequence:CCGGACCGGAGTCCATAGCACATATCTCGAGATATGTGCTATGGACTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020531
VALIDATED
APMAP MISSION shRNA Lentiviral Transduction Particles
adipocyte plasma membrane associated protein
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369438    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020531.2-1762s21c1
Sequence:CCGGATATATAACGTGCGGTCATACCTCGAGGTATGACCGCACGTTATATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020531.2-1004s1c1
Sequence:CCGGGCCTGGATTTCCAGACAACATCTCGAGATGTTGTCTGGAAATCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020531.2-1145s1c1
Sequence:CCGGCTTTAGTCAAGAGACGGTGATCTCGAGATCACCGTCTCTTGACTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020531.2-336s21c1
Sequence:CCGGCTTGGTGTTCTGCATCCAAATCTCGAGATTTGGATGCAGAACACCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020531.2-758s1c1
Sequence:CCGGCAAATGGCAAAGACGAGACTACTCGAGTAGTCTCGTCTTTGCCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020531.2-1739s1c1
Sequence:CCGGCGGCCTCAAAGTTCTTCTTTACTCGAGTAAAGAAGAACTTTGAGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020531.2-1142s1c1
Sequence:CCGGGCTCTTTAGTCAAGAGACGGTCTCGAGACCGTCTCTTGACTAAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020531.2-1107s21c1
Sequence:CCGGTCTGAGAGACCCTGGATTAAACTCGAGTTTAATCCAGGGTCTCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020531.2-830s21c1
Sequence:CCGGTACTGTGACCAGGGAAGTAAACTCGAGTTTACTTCCCTGGTCACAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020531.2-721s21c1
Sequence:CCGGAGGATGGGAGGAAGATTTATTCTCGAGAATAAATCTTCCTCCCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020531.2-1564s21c1
Sequence:CCGGTATCTGCCATGAGGAACATAACTCGAGTTATGTTCCTCATGGCAGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020531.2-599s21c1
Sequence:CCGGCGATGCATACAAGGGACTATTCTCGAGAATAGTCCCTTGTATGCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020531.2-404s21c1
Sequence:CCGGACCGGAGTCCATAGCACATATCTCGAGATATGTGCTATGGACTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027977
APMAP MISSION shRNA Bacterial Glycerol Stock
adipocyte plasma membrane associated protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027977.1-877s1c1
Sequence:CCGGGCCAGGATACGAAGAGTCTATCTCGAGATAGACTCTTCGTATCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027977.1-661s1c1
Sequence:CCGGCGGGATGGAAGGAAGATTTATCTCGAGATAAATCTTCCTTCCATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027977.1-659s1c1
Sequence:CCGGCTCGGGATGGAAGGAAGATTTCTCGAGAAATCTTCCTTCCATCCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027977.2-341s21c1
Sequence:CCGGTGGACCAGAATCCATAGTAAACTCGAGTTTACTATGGATTCTGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027977.1-292s1c1
Sequence:CCGGCCAAATACGAAGTTGCGGCAACTCGAGTTGCCGCAACTTCGTATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027977.2-658s21c1
Sequence:CCGGCTCGGGATGGAAGGAAGATTTCTCGAGAAATCTTCCTTCCATCCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027977.2-1780s21c1
Sequence:CCGGGCAGGGATTATTCAAGCTGAACTCGAGTTCAGCTTGAATAATCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027977.2-876s21c1
Sequence:CCGGGCCAGGATACGAAGAGTCTATCTCGAGATAGACTCTTCGTATCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027977.2-1105s21c1
Sequence:CCGGTGAAGTTTGTGCCACGATATACTCGAGTATATCGTGGCACAAACTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027977
APMAP MISSION shRNA shRNA Plasmid DNA
adipocyte plasma membrane associated protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027977.1-877s1c1
Sequence:CCGGGCCAGGATACGAAGAGTCTATCTCGAGATAGACTCTTCGTATCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027977.1-661s1c1
Sequence:CCGGCGGGATGGAAGGAAGATTTATCTCGAGATAAATCTTCCTTCCATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027977.1-659s1c1
Sequence:CCGGCTCGGGATGGAAGGAAGATTTCTCGAGAAATCTTCCTTCCATCCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027977.2-341s21c1
Sequence:CCGGTGGACCAGAATCCATAGTAAACTCGAGTTTACTATGGATTCTGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027977.1-292s1c1
Sequence:CCGGCCAAATACGAAGTTGCGGCAACTCGAGTTGCCGCAACTTCGTATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027977.2-658s21c1
Sequence:CCGGCTCGGGATGGAAGGAAGATTTCTCGAGAAATCTTCCTTCCATCCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027977.2-1780s21c1
Sequence:CCGGGCAGGGATTATTCAAGCTGAACTCGAGTTCAGCTTGAATAATCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027977.2-876s21c1
Sequence:CCGGGCCAGGATACGAAGAGTCTATCTCGAGATAGACTCTTCGTATCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027977.2-1105s21c1
Sequence:CCGGTGAAGTTTGTGCCACGATATACTCGAGTATATCGTGGCACAAACTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027977
APMAP MISSION shRNA Lentiviral Transduction Particles
adipocyte plasma membrane associated protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027977.1-877s1c1
Sequence:CCGGGCCAGGATACGAAGAGTCTATCTCGAGATAGACTCTTCGTATCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027977.1-661s1c1
Sequence:CCGGCGGGATGGAAGGAAGATTTATCTCGAGATAAATCTTCCTTCCATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027977.1-659s1c1
Sequence:CCGGCTCGGGATGGAAGGAAGATTTCTCGAGAAATCTTCCTTCCATCCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027977.2-341s21c1
Sequence:CCGGTGGACCAGAATCCATAGTAAACTCGAGTTTACTATGGATTCTGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027977.1-292s1c1
Sequence:CCGGCCAAATACGAAGTTGCGGCAACTCGAGTTGCCGCAACTTCGTATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027977.2-658s21c1
Sequence:CCGGCTCGGGATGGAAGGAAGATTTCTCGAGAAATCTTCCTTCCATCCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027977.2-1780s21c1
Sequence:CCGGGCAGGGATTATTCAAGCTGAACTCGAGTTCAGCTTGAATAATCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027977.2-876s21c1
Sequence:CCGGGCCAGGATACGAAGAGTCTATCTCGAGATAGACTCTTCGTATCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027977.2-1105s21c1
Sequence:CCGGTGAAGTTTGTGCCACGATATACTCGAGTATATCGTGGCACAAACTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)