EMAIL THIS PAGE TO A FRIEND

APOL5

apolipoprotein L, 5

22 Gene Product Result for
Synonyms: APOL-V APOLV
UniProtKB ID: Q9BWW9, Q5TFL9, Q9UGW5
Gene ID:
Human(80831) Summary: This gene is a member of the apolipoprotein L gene family. The encoded protein is found in the cytoplasm, where it may affect the movement of lipids or allow the binding of lipids to organelles. [provided by RefSeq, Jul 2008]
domestic cat(101090878) apolipoprotein L, 5
dog(474520) apolipoprotein L, 5
sheep(101105566) apolipoprotein L, 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030642 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007801 MISSION® esiRNA esiRNA targeting human APOL5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030642 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108701 predicted 544
2 SASI_Hs01_00108702 predicted 371
3 SASI_Hs02_00358219 predicted 754
4 SASI_Hs01_00108703 predicted 1092
5 SASI_Hs01_00108704 predicted 790
6 SASI_Hs01_00108705 predicted 573
7 SASI_Hs01_00108706 predicted 205
8 SASI_Hs02_00358220 predicted 535
9 SASI_Hs01_00108707 predicted 458
10 SASI_Hs01_00108708 predicted 819
11 SASI_Hs01_00108709 predicted 474
12 SASI_Hs01_00108710 predicted 365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030642
APOL5 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein L, 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-88s1c1
Sequence:CCGGCGAAAGGTAATCTACGGAGGTCTCGAGACCTCCGTAGATTACCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-1109s1c1
Sequence:CCGGGTGTGGTTAAACCAGAAGGGTCTCGAGACCCTTCTGGTTTAACCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-647s1c1
Sequence:CCGGGAGGAATAAATTGGTCTGAAACTCGAGTTTCAGACCAATTTATTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-895s1c1
Sequence:CCGGGCTGGCTTCTTACTTATGAAACTCGAGTTTCATAAGTAAGAAGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-542s1c1
Sequence:CCGGCCATCACCAACATAGTAACAACTCGAGTTGTTACTATGTTGGTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-541s1c1
Sequence:CCGGGCCATCACCAACATAGTAACACTCGAGTGTTACTATGTTGGTGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-249s1c1
Sequence:CCGGGCGATGTGACAAAGATTCCATCTCGAGATGGAATCTTTGTCACATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-244s1c1
Sequence:CCGGCTGATGCGATGTGACAAAGATCTCGAGATCTTTGTCACATCGCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-211s1c1
Sequence:CCGGGCTGGTATGCTGTCCTACTTTCTCGAGAAAGTAGGACAGCATACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030642
APOL5 MISSION shRNA shRNA Plasmid DNA
apolipoprotein L, 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-88s1c1
Sequence:CCGGCGAAAGGTAATCTACGGAGGTCTCGAGACCTCCGTAGATTACCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-1109s1c1
Sequence:CCGGGTGTGGTTAAACCAGAAGGGTCTCGAGACCCTTCTGGTTTAACCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-647s1c1
Sequence:CCGGGAGGAATAAATTGGTCTGAAACTCGAGTTTCAGACCAATTTATTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-895s1c1
Sequence:CCGGGCTGGCTTCTTACTTATGAAACTCGAGTTTCATAAGTAAGAAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-542s1c1
Sequence:CCGGCCATCACCAACATAGTAACAACTCGAGTTGTTACTATGTTGGTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-541s1c1
Sequence:CCGGGCCATCACCAACATAGTAACACTCGAGTGTTACTATGTTGGTGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-249s1c1
Sequence:CCGGGCGATGTGACAAAGATTCCATCTCGAGATGGAATCTTTGTCACATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-244s1c1
Sequence:CCGGCTGATGCGATGTGACAAAGATCTCGAGATCTTTGTCACATCGCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-211s1c1
Sequence:CCGGGCTGGTATGCTGTCCTACTTTCTCGAGAAAGTAGGACAGCATACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030642
APOL5 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein L, 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-88s1c1
Sequence:CCGGCGAAAGGTAATCTACGGAGGTCTCGAGACCTCCGTAGATTACCTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-1109s1c1
Sequence:CCGGGTGTGGTTAAACCAGAAGGGTCTCGAGACCCTTCTGGTTTAACCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-647s1c1
Sequence:CCGGGAGGAATAAATTGGTCTGAAACTCGAGTTTCAGACCAATTTATTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-895s1c1
Sequence:CCGGGCTGGCTTCTTACTTATGAAACTCGAGTTTCATAAGTAAGAAGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-542s1c1
Sequence:CCGGCCATCACCAACATAGTAACAACTCGAGTTGTTACTATGTTGGTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-541s1c1
Sequence:CCGGGCCATCACCAACATAGTAACACTCGAGTGTTACTATGTTGGTGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-249s1c1
Sequence:CCGGGCGATGTGACAAAGATTCCATCTCGAGATGGAATCTTTGTCACATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-244s1c1
Sequence:CCGGCTGATGCGATGTGACAAAGATCTCGAGATCTTTGTCACATCGCATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030642.1-211s1c1
Sequence:CCGGGCTGGTATGCTGTCCTACTTTCTCGAGAAAGTAGGACAGCATACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)