EMAIL THIS PAGE TO A FRIEND

APP

amyloid beta (A4) precursor protein

303 Gene Product Result for
Synonyms: AAA ABETA ABPP AD1 APPI CTFgamma CVAP PN-II PN2
Gene ID:
Human(351) Summary: This gene encodes a cell surface receptor and transmembrane precursor protein that is cleaved by secretases to form a number of peptides. Some of these peptides are secreted and can bind to the acetyltransferase complex APBB1/TIP60 to promote transcriptional activation, while others form the protein basis of the amyloid plaques found in the brains of patients with Alzheimer disease. Mutations in this gene have been implicated in autosomal dominant Alzheimer disease and cerebroarterial amyloidosis (cerebral amyloid angiopathy). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11820) amyloid beta (A4) precursor protein
Rat(54226) amyloid beta (A4) precursor protein
fruit fly(39399) approximated
chicken(374198) amyloid beta (A4) precursor protein
domestic cat(101085564) amyloid beta (A4) precursor protein
cow(280722) amyloid beta (A4) precursor protein
dog(403407) amyloid beta (A4) precursor protein
naked mole-rat(101724743) amyloid beta (A4) precursor protein
domestic guinea pig(100715302) amyloid beta (A4) precursor protein
sheep(101111593) amyloid beta (A4) precursor protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
ABN1665 Anti-Aβ-42 Antibody, oligomeric (VIA) clone, from rabbit human, human, human
dot blot, neutralization, western blot pricing
ABN1650 Anti-Aβ-42 Antibody, oligomeric (VIA) serum, clone, from rabbit human, human, human
dot blot, immunofluorescence, immunohistochemistry, western blot pricing
FCMAB327F Anti-Alzheimer Precursor Protein A4 (NT)-FITC Antibody, clone 22C11 clone 22C11, Milli-Mark®, from mouse canine
flow cytometry pricing
MAB348A4 Anti-Alzheimer Precursor Protein A4 Antibody, clone 22C11, Alexa488 Conj. clone 22C11, from mouse, ALEXA FLUOR® 488 rat, monkey, human, mouse, pig, rat, rat, canine
immunocytochemistry, immunohistochemistry pricing
MAB348B Anti-Alzheimer Precursor Protein A4 Antibody, clone 22C11, Biotin Conj. | MAB348B clone 22C11, from mouse, biotin conjugate monkey, pig, canine, rat, rat, rat, mouse, human
immunocytochemistry, immunohistochemistry pricing
MAB5208 Anti-Amyloid Antibody, β 1-16, clone AB10 clone AB10, Chemicon®, from mouse bovine, human, monkey
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
MAB5206 Anti-Amyloid Antibody, β 1-16, clone DE2 culture supernatant, clone DE2, Chemicon® monkey, bovine, human
ELISA, immunohistochemistry, western blot pricing
AB5074P Anti-Amyloid Antibody, β 1-40 clone, Chemicon®, from rabbit mouse, human
ELISA, immunohistochemistry, western blot pricing
MAB5226 Anti-Amyloid Antibody, β 1-40, clone OM16 clone OM16, Chemicon®, from mouse human
ELISA, western blot pricing
AB5076 Anti-Amyloid Antibody, β 1-40/42 serum, clone, Chemicon® mouse, human
ELISA, immunohistochemistry, western blot pricing
AB5306 Anti-Amyloid Antibody, β 37-42, aβ serum, clone, Chemicon® human
ELISA, immunohistochemistry pricing
05-799 Anti-Amyloid β (Aβ)x-40 Antibody, clone 11A5-B10 ascites fluid, clone 11A5-B10, Upstate® mouse, human
immunohistochemistry, western blot pricing
AB1510 Anti-Amyloid β Antibody, aa1-14 h β-amyloid serum, clone, Chemicon® human
immunohistochemistry, western blot pricing
MABN10 Anti-Amyloid β Antibody, clone W0-2 clone WO2, from mouse mouse, human
ELISA, immunohistochemistry, western blot pricing
MAB5354 Anti-Amyloid β Precursor Protein Antibody, KPI domain, clone 4.1 clone 4.1, Chemicon®, from mouse human
ELISA, immunohistochemistry, western blot pricing
MABN11 Anti-Amyloid β40 Antibody, clone G2-10 clone G2-10, from mouse human, mouse
ELISA, immunohistochemistry, western blot pricing
MABN12 Anti-Amyloid β42 Antibody, clone G2-11 clone G2-11, from mouse human, mouse
ELISA, immunohistochemistry, western blot pricing
MABN13 Anti-Amyloid β42 Antibody, clone G2-13 clone G2-13, from mouse mouse, human, human, human
ELISA, immunohistochemistry, western blot pricing
MABN639 Anti-Amyloid βA4, clone 1E8 (Amino Terminus) Antibody clone 1E8, 1 mg/mL, from mouse human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
05-831-I Anti-Amyloid Beta (ABeta) x-42 Antibody, clone 12F4 clone 12F4, from mouse human
ELISA, immunohistochemistry pricing
MABN779 Anti-Amyloid Beta 3NTyr10 Antibody, clone 4A5E8 clone 4A5E8, from mouse human, human, human
ELISA, immunohistochemistry pricing
AB2500 Anti-Amyloid beta A4 protein Antibody clone, from rabbit, purified by affinity chromatography mouse, pig, rat, horse, human, rat, canine, bovine, mouse, guinea pig, human
immunohistochemistry, western blot pricing
MABN2273 Anti-Amyloid Beta A4 protein Antibody, clone 2D8 clone 2D8, from rat human, human, mouse, mouse
immunoprecipitation (IP), western blot pricing
MABN2295 Anti-Amyloid beta A4 protein Antibody, clone 2E9 clone 2E9, from rat human, mouse, mouse, human
immunofluorescence, immunoprecipitation (IP), western blot pricing
MABN637 Anti-Amyloid beta fibrils, clone M64, Rabbit Monoclonal Antibody clone M64, from rabbit human, human
dot blot, immunohistochemistry, immunoprecipitation (IP), western blot pricing
MABN640 Anti-Amyloid beta fibrils, clone M98, Rabbit Monoclonal Antibody clone M98, from rabbit human, human
dot blot, immunohistochemistry, western blot pricing
MABN254 Anti-amyloid beta peptide (MOAB-2), pan Antibody, clone 6C3 clone 6C3, from mouse human
dot blot, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
AB9234 Anti-Amyloid Oligomer Antibody, αβ, oligomeric serum, clone, Chemicon® mouse, rat, human, rat, eukaryotes, mouse
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
A1976 Anti-Amyloid Peptide β, Cleavage Site 42 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
dot blot, ELISA, immunohistochemistry, immunoprecipitation (IP), radioimmunoassay, western blot pricing
AB1593 Anti-Amyloid Precursor Protein Antibody, a.a. 44-63 serum, clone, Chemicon® human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
MAB349 Anti-Amyloid Precursor Protein Antibody, A4(695), clone 1.D5 clone 1.D5, Chemicon®, from mouse rat, human
western blot pricing
AB5352 Anti-Amyloid Precursor Protein Antibody, CT serum, clone, Chemicon® human, monkey
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
AB5988P Anti-Amyloid Precursor Protein Antibody, Domain 770 clone, Chemicon®, from rabbit human, monkey
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
AB5302 Anti-Amyloid Precursor Protein Antibody, KPI Domain serum, clone, Chemicon® monkey, mouse, bovine, human
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
MAB5228 Anti-Amyloid Precursor Protein Antibody, Secretory, clone OM84 clone OM84, Chemicon®, from mouse human
ELISA, western blot pricing
AB5300 Anti-Amyloid Precursor Protein Antibody, universal serum, clone, Chemicon® human, mouse, monkey
immunoprecipitation (IP), western blot pricing
A8717 Anti-Amyloid Precursor Protein, C-Terminal antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Antibody Enhanced Validation human, mouse, rat
immunohistochemistry, microarray, western blot pricing
A8842 Anti-Amyloid Precursor Protein, KPI Domain antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, rat, human
immunohistochemistry, microarray pricing
A8967 Anti-Amyloid Precursor Protein, N-Terminal antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse, rat
immunohistochemistry, microarray, western blot pricing
ABN240 Anti-Amyloid, β 1-40, aβ Antibody clone, from rabbit, purified by affinity chromatography human, human, human
ELISA, immunohistochemistry, western blot pricing
MABN1839 Anti-Amyloid-β (oligomer) Antibody, clone F11G3 clone F11G3, from mouse mouse, all, human, human, mouse
dot blot, ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB4300464 Anti-APP (Ab-668) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, western blot pricing
SAB2100135 Anti-APP (ab2) antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, dog, human, mouse, horse, rat, bovine
western blot pricing
SAB2100136 Anti-APP (ab3) antibody produced in rabbit IgG fraction of antiserum rat, rabbit, horse, guinea pig, mouse, bovine, human, dog
immunohistochemistry, western blot pricing
SAB4200536 Anti-APP (N-terminal region) antibody produced in rabbit IgG fraction of antiserum human, rat, mouse
immunofluorescence, western blot pricing
SAB2501664 Anti-App (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse
ELISA, western blot pricing
SAB2502012 Anti-APP (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, pig, canine, human
ELISA, western blot pricing
IHCR1002-6 Anti-APP A4 Antibody, a.a. 66-81 (NT), Prediluted, clone 22C11 clone 22C11, Chemicon®, from mouse pig, fish, rat, mouse, human, canine, monkey
immunohistochemistry pricing
MAB348 Anti-APP A4 Antibody, a.a. 66-81 of APP {NT}, clone 22C11 clone 22C11, Chemicon®, from mouse human, fish, canine, monkey, pig, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
MAB348-AF555 Anti-APP A4 Antibody, a.a. 66-81 of APP {NT}, clone 22C11, Alexa Fluor 555 clone 22C11, from mouse, ALEXA FLUOR® 555 canine, human, fish, rat, monkey, porcine, mouse
immunocytochemistry pricing
MAB348-AF647 Anti-APP A4, a.a. 66-81 of APP {NT} Antibody, clone 22C11, Alexa Fluor 647 Conjugate clone 22C11, from mouse, ALEXA FLUOR® 647 canine, mouse, porcine, monkey, fish, human, rat
immunocytochemistry pricing
07-667 Anti-APP Antibody clone, Upstate®, from rabbit human, rat, mouse
immunoprecipitation (IP), western blot pricing
HPA001462 Anti-APP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB4200535 Anti-APP antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, immunoprecipitation (IP) pricing
SAB5200113 Anti-APP antibody produced in rabbit 1 mg/mL, affinity isolated antibody eukaryotes, human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB2107345 Anti-APP antibody produced in rabbit affinity isolated antibody bovine, horse, human, rabbit, guinea pig, rat, dog, mouse
western blot pricing
SAB3500274 Anti-APP antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
ABN1643 Anti-APP Antibody, AEP-cleaved (373N) serum, clone, from rabbit human, mouse, human, mouse
immunohistochemistry, western blot pricing
ABN1642 Anti-APP Antibody, AEP-cleaved (585N) serum, clone, from rabbit mouse, human, mouse, human
immunohistochemistry, western blot pricing
MAB343 Anti-APP Antibody, APP 643-695 CT fragment, clone 2.F2.19B4 ascites fluid, clone 2.F2.19B4, Chemicon® human, rat
immunohistochemistry, western blot pricing
MABN2287 Anti-APP Antibody, clone 1D1 clone 1D1, from rat human, human, human
ELISA, flow cytometry, immunocytochemistry, immunohistochemistry, western blot pricing
MABN852 Anti-APP Antibody, clone 2B3 clone 2B3, from mouse mouse, human, mouse, human
ELISA, immunocytochemistry, inhibition assay, western blot pricing
MABN2297 Anti-APP Antibody, clone 7H6 clone 7H6, from rat human, human
ELISA, flow cytometry, immunocytochemistry, immunoprecipitation (IP), western blot pricing
MAB343-C Anti-APP Antibody, CT, clone 2.F2.19B4, Ascites Free clone 2.F2.19B4, from mouse human, mouse, mouse, human, human, mouse
affinity binding assay, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
MABN381 Anti-APP-C99 Antibody, clone mC99(1-7) ascites fluid, clone mC99(1-7), from mouse human, mouse
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
MABN380 Anti-APP-C99 Antibody, clone mC99(70–80) ascites fluid, clone mC99(70-80), from mouse mouse, human
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
ABN1641 Anti-APP585C serum, clone, from rabbit mouse, mouse, human, human
immunohistochemistry, western blot pricing
A8978 Anti-β-Amyloid (13-28) antibody, Mouse monoclonal clone BAM90.1, purified from hybridoma cell culture human
enzyme immunoassay, immunohistochemistry, immunoprecipitation (IP), western blot pricing
A3356 Anti-β-Amyloid (22-35) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing
MABN687 Anti-β-amyloid fibril-specific, clone B10, AP Antibody clone B10, from camel, alkaline phosphatase conjugate human
dot blot, ELISA, immunofluorescence, immunohistochemistry, immunoprecipitation (IP) pricing
A8326 Anti-β-Amyloid Protein (1-40) antibody produced in rabbit whole antiserum human
dot blot, immunohistochemistry pricing
AB5078P Anti-Beta-Amyloid 1-42 Antibody clone, Chemicon®, from rabbit mouse, human, chicken
ELISA, immunohistochemistry, western blot pricing
SAB4503755 Anti-phospho-Amyloid β A4 (pThr743/668) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
MABN878 Anti-phospho-Amyloid beta (Ser8) Antibody, clone 1E4E11 clone 1E4E11, from mouse human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
MABN879 Anti-phospho-Amyloid beta Antibody (Ser26), clone 5H11C10 clone 5H11C10, from mouse human, human, human
ELISA, immunofluorescence, western blot pricing
SAB4300153 Anti-phospho-APP (p668) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
A9103 Anti-phospho-APP (pThr668) antibody produced in rabbit affinity isolated antibody, aqueous glycerol solution, 10 blots human
western blot pricing
SAB5700277 Anti-Phospho-APP-T668 antibody produced in rabbit New rat, mouse
western blot pricing
SAB4100500 Monoclonal Anti-APP antibody produced in mouse clone APP-B434, culture supernatant human
western blot pricing
SAB4100478 Monoclonal Anti-APP antibody produced in mouse clone APP-A434, culture supernatant human
western blot pricing
SAB1403560 Monoclonal Anti-APP antibody produced in mouse clone 1E6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
WH0000351M1 Monoclonal Anti-APP antibody produced in mouse clone 2C12, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
A8354 Monoclonal Anti-β-Amyloid antibody produced in mouse clone NAB 228, purified from hybridoma cell culture human
ELISA, immunohistochemistry, immunoprecipitation (IP), microarray, western blot pricing
A5213 Monoclonal Anti-β-Amyloid antibody produced in mouse clone BAM-10, ascites fluid human
ELISA, immunohistochemistry pricing
A3981 Monoclonal Anti-β-Amyloid antibody produced in mouse clone BAM-10, purified from hybridoma cell culture human
ELISA, immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
45710 Eserine ≥98.0% (N) human, mouse, rat pricing
E8375 Eserine human, mouse, rat pricing

Proteins

Product # Description Species Add to Cart
 
A1222 7-Methoxycoumarin-4-acetyl-[Asn670, Leu671]-Amyloid β/A4 Precursor Protein 770 Fragment 667-674-(2,4-dinitrophenol)Dap ≥97% (HPLC) human pricing
A1472 7-Methoxycoumarin-4-acetyl-[Asn670, Leu671]-Amyloid β/A4 Precursor Protein 770 Fragment 667-676-(2,4-dinitrophenyl)Lys-Arg-Arg amide ≥90% (HPLC) human pricing
A1597 7-Methoxycoumarin-4-acetyl-[Asn670, Leu671]-Amyloid β/A4 Precursor Protein 770 Fragment 669-674-(2,4-dinitrophenyl)Lys trifluoroacetate salt ≥96% (HPLC) human pricing
SCP0002 Acetyl-Amyloid β 25-35 human pricing
A6933 Acetyl-Amyloid β-Protein Fragment 15-20 Amide ≥97% (HPLC), powder human pricing
SCP0041 [Ala28]-Amyloid β 25-35 ≥95% (HPLC) human pricing
A0189 Amyloid β Protein Fragment 1-38 ≥95% (HPLC), powder human pricing
A1075 Amyloid β Protein Fragment 1-40 ≥90% (HPLC), powder human pricing
A9810 Amyloid β Protein Fragment 1-42 human pricing
A4473 Amyloid β-Protein Fragment 1-40 amide trifluoroacetate salt ≥95% (HPLC), lyophilized powder human pricing
A7712 Amyloid β-Protein Fragment 1-43 human pricing
A4723 Amyloid β-Protein Fragment 17-28 ≥90% (HPLC), lyophilized powder human pricing
A4848 Amyloid β-Protein Fragment 17-40 ≥87% (HPLC), lyophilized powder human pricing
A5080 Amyloid β-Protein Fragment 22-35 ≥95% (HPLC) human pricing
A4559 Amyloid β-Protein Fragment 25-35 ≥97% (HPLC) human pricing
A2201 Amyloid β-Protein Fragment 35-25 ≥95% (HPLC) human pricing
A2326 Amyloid β-Protein Fragment 40-1 ≥90% (HPLC) human pricing
A3347 Amyloid BRI Protein Precursor 227 Fragment 89-106 ≥81% (HPLC), solid human pricing
S8065 Amyloid Precursor Protein α (304-612), Secreted human >90% (SDS-PAGE), recombinant, expressed in E. coli (N-terminal histidine tagged), buffered aqueous solution human pricing
S9564 Amyloid Precursor Protein α, Secreted human >90% (SDS-PAGE), recombinant, expressed in E. coli (N-terminal histidine tagged), buffered aqueous solution human pricing
S4316 Amyloid Precursor Protein β, Secreted human ≥85% (SDS-PAGE), recombinant, expressed in E. coli (N-terminal histidine tagged), solution, sterile; 0.2 μm filtered human pricing
A1473 Amyloid Precursor Protein N-Terminal Peptide lyophilized powder human pricing
A7973 [Arg13] Amyloid-β-Protein Fragment 1-40 ≥80% (HPLC), lyophilized powder human pricing
A1097 [Asn(4-aminobutyl)1,7,23,Gln(4-aminobutyl)3,11,22]-Amyloid β-Protein 1-40 ≥90% (HPLC) human pricing
A1972 [Asn670, Leu671]-Amyloid β/A4 Precursor Protein 770 Fragment 667-676 trifluoroacetate salt ≥95% (HPLC), solid human pricing
AG918 β Amyloid 1-40, aβ, F4W, TFA, recombinant human human pricing
AG962 β Amyloid 1-40, aβ, ultra pure, HFIP, recombinant human human pricing
AG964 β Amyloid 1-40, aβ, ultra pure, NaOH, recombinant human human pricing
AG910 β Amyloid 1-40, aβ, ultra pure, TFA, recombinant human human pricing
AG916 β Amyloid 1-42, aβ, scrambled, TFA, recombinant E. coli human pricing
AG972 β Amyloid 1-42, aβ, ultra pure, HCl, recombinant human human pricing
AG968 β Amyloid 1-42, aβ, ultra pure, HFIP, recombinant human human pricing
AG970 β Amyloid 1-42, aβ, ultra pure, NaOH, recombinant human human pricing
AG912 β Amyloid 1-42, aβ, ultra pure, TFA, recombinant human human pricing
A4972 DABCYL-[Asn670, Leu671]-Amyloid β/A4 Precursor Protein 770 fragment 661-675−EDANS trifluoroacetate salt ≥97% (HPLC), solid human pricing
A5097 DABCYL-[Asn670, Leu671]-Amyloid β/A4 Precursor Protein 770 Fragment 669-674-EDANS ammonium salt ≥95% (HPLC), solid human pricing
SCP0031 [Glu11]-Amyloid β 10-16 human ≥95% (HPLC) human pricing
SCP0029 [Gly22]-Amyloid β 1-40 Arctic human ≥95% (HPLC) human pricing
SCP0030 [Gly22]-Amyloid β 1-42 Arctic human human pricing
A4348 [Nle35]-Amyloid β-Protein Fragment 1-40 ≥90% (HPLC), lyophilized powder human pricing
A2597 [pGlu3]-Amyloid β-Protein Fragment 3-42 ≥90% (HPLC), solid human pricing
A4223 [Phe10]-Amyloid β-Protein Fragment 1-40 ≥95% (HPLC), lyophilized powder human pricing
APREST77493 PrEST Antigen APP Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST22650 SILuPrEST A4 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
A2722 [Val671]-Amyloid β/A4 Precursor Protein 770 Fragment 667-676 trifluoroacetate salt ≥95% (HPLC), solid human pricing
A5973 Amyloid-β-Protein Fragment 1-40, All D-Amino Acids >70% (HPLC), lyophilized powder human, mouse, rat pricing
AG542 β amyloid 1-42, rat and mouse mouse, rat pricing
AG546 β amyloid 11-40, rat and mouse mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000484 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000484 siRNAs that have been validated in the lab human pricing
NM_201413 Rosetta Predictions human pricing
NM_201414 Rosetta Predictions human pricing
NM_019288 Rosetta Predictions rat pricing
NM_007471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000484 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185800 validated 2273
1 SASI_Hs01_00185799 validated 544
1 SASI_Hs01_00185801 validated 313
2 SASI_Hs02_00302631 predicted 549
3 SASI_Hs02_00302632 predicted 1970
4 SASI_Hs01_00185803 predicted 1796
5 SASI_Hs01_00185805 predicted 582
6 SASI_Hs02_00302633 predicted 2285
7 SASI_Hs01_00185808 predicted 1714
8 SASI_Hs02_00302634 predicted 1856
9 SASI_Hs02_00302635 predicted 608
10 SASI_Hs01_00185802 predicted 2224
11 SASI_Hs01_00185804 predicted 2284
12 SASI_Hs01_00185806 predicted 2585
13 SASI_Hs01_00185807 predicted 2309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372947 predicted 552
2 SASI_Hs01_00068225 predicted 537
3 SASI_Hs01_00068227 predicted 308
4 SASI_Hs02_00372948 predicted 1911
5 SASI_Hs01_00068229 predicted 1735
6 SASI_Hs01_00068231 predicted 579
7 SASI_Hs02_00372949 predicted 2226
8 SASI_Hs01_00068234 predicted 1656
9 SASI_Hs02_00372950 predicted 1804
10 SASI_Hs02_00372951 predicted 611
11 SASI_Hs01_00068226 predicted 2218
12 SASI_Hs01_00068228 predicted 2159
13 SASI_Hs01_00068230 predicted 2219
14 SASI_Hs01_00068232 predicted 2537
15 SASI_Hs01_00068233 predicted 2251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372952 predicted 550
2 SASI_Hs01_00177201 predicted 540
3 SASI_Hs01_00177203 predicted 308
4 SASI_Hs02_00372953 predicted 1745
5 SASI_Hs01_00177205 predicted 1566
6 SASI_Hs01_00177207 predicted 581
7 SASI_Hs02_00372954 predicted 2065
8 SASI_Hs01_00177210 predicted 1488
9 SASI_Hs02_00372955 predicted 1635
10 SASI_Hs02_00372956 predicted 611
11 SASI_Hs01_00177202 predicted 2050
12 SASI_Hs01_00177204 predicted 1995
13 SASI_Hs01_00177206 predicted 2059
14 SASI_Hs01_00177208 predicted 2369
15 SASI_Hs01_00177209 predicted 2083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086595 predicted 366
2 SASI_Rn01_00086596 predicted 2006
3 SASI_Rn01_00086597 predicted 2095
4 SASI_Rn01_00086598 predicted 1000
5 SASI_Rn01_00086600 predicted 606
6 SASI_Rn01_00086601 predicted 1852
7 SASI_Rn02_00262230 predicted 368
8 SASI_Rn01_00086602 predicted 1623
9 SASI_Rn01_00086603 predicted 497
10 SASI_Rn01_00086604 predicted 501
11 SASI_Rn01_00086599 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068884 predicted 253
2 SASI_Mm01_00068885 predicted 1956
3 SASI_Mm01_00068886 predicted 1938
4 SASI_Mm01_00068887 predicted 1907
5 SASI_Mm01_00068888 predicted 1986
6 SASI_Mm01_00068889 predicted 271
7 SASI_Mm01_00068890 predicted 621
8 SASI_Mm01_00068891 predicted 2180
9 SASI_Mm01_00068892 predicted 1522
10 SASI_Mm01_00068893 predicted 1251
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000484
VALIDATED
APP MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-1237s21c1
Sequence:CCGGCCCAAAGTTTACTCAAGACTACTCGAGTAGTCTTGAGTAAACTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-1982s21c1
Sequence:CCGGGCCATCTTTGACCGAAACGAACTCGAGTTCGTTTCGGTCAAAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-837s21c1
Sequence:CCGGGCAGACACAGACTATGCAGATCTCGAGATCTGCATAGTCTGTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000484.3-3208s21c1
Sequence:CCGGCCCTGTTCATTGTAAGCACTTCTCGAGAAGTGCTTACAATGAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-1231s1c1
Sequence:CCGGCCCAAAGTTTACTCAAGACTACTCGAGTAGTCTTGAGTAAACTTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-1976s1c1
Sequence:CCGGGCCATCTTTGACCGAAACGAACTCGAGTTCGTTTCGGTCAAAGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000484.2-540s1c1
Sequence:CCGGCGCTGCTTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAAGCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-831s1c1
Sequence:CCGGGCAGACACAGACTATGCAGATCTCGAGATCTGCATAGTCTGTGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-3202s1c1
Sequence:CCGGCCCTGTTCATTGTAAGCACTTCTCGAGAAGTGCTTACAATGAACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000484
VALIDATED
APP MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-1237s21c1
Sequence:CCGGCCCAAAGTTTACTCAAGACTACTCGAGTAGTCTTGAGTAAACTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-1982s21c1
Sequence:CCGGGCCATCTTTGACCGAAACGAACTCGAGTTCGTTTCGGTCAAAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-837s21c1
Sequence:CCGGGCAGACACAGACTATGCAGATCTCGAGATCTGCATAGTCTGTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000484.3-3208s21c1
Sequence:CCGGCCCTGTTCATTGTAAGCACTTCTCGAGAAGTGCTTACAATGAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-1231s1c1
Sequence:CCGGCCCAAAGTTTACTCAAGACTACTCGAGTAGTCTTGAGTAAACTTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-1976s1c1
Sequence:CCGGGCCATCTTTGACCGAAACGAACTCGAGTTCGTTTCGGTCAAAGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000484.2-540s1c1
Sequence:CCGGCGCTGCTTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAAGCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-831s1c1
Sequence:CCGGGCAGACACAGACTATGCAGATCTCGAGATCTGCATAGTCTGTGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-3202s1c1
Sequence:CCGGCCCTGTTCATTGTAAGCACTTCTCGAGAAGTGCTTACAATGAACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000484
VALIDATED
APP MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-1237s21c1
Sequence:CCGGCCCAAAGTTTACTCAAGACTACTCGAGTAGTCTTGAGTAAACTTTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000318477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-1982s21c1
Sequence:CCGGGCCATCTTTGACCGAAACGAACTCGAGTTCGTTTCGGTCAAAGATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000318475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000484.3-837s21c1
Sequence:CCGGGCAGACACAGACTATGCAGATCTCGAGATCTGCATAGTCTGTGTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000349493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000484.3-3208s21c1
Sequence:CCGGCCCTGTTCATTGTAAGCACTTCTCGAGAAGTGCTTACAATGAACAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000011042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-1231s1c1
Sequence:CCGGCCCAAAGTTTACTCAAGACTACTCGAGTAGTCTTGAGTAAACTTTGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000011043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-1976s1c1
Sequence:CCGGGCCATCTTTGACCGAAACGAACTCGAGTTCGTTTCGGTCAAAGATGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000484.2-540s1c1
Sequence:CCGGCGCTGCTTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAAGCAGCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-831s1c1
Sequence:CCGGGCAGACACAGACTATGCAGATCTCGAGATCTGCATAGTCTGTGTCTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000484.2-3202s1c1
Sequence:CCGGCCCTGTTCATTGTAAGCACTTCTCGAGAAGTGCTTACAATGAACAGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007471
APP MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007471.2-2948s21c1
Sequence:CCGGCCTGTTCATCATAAGCACTTTCTCGAGAAAGTGCTTATGATGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-491s21c1
Sequence:CCGGCGTTGCCTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAGGCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-1583s21c1
Sequence:CCGGGCTGAGGAGATTCAAGATGAACTCGAGTTCATCTTGAATCTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007471.2-2948s1c1
Sequence:CCGGCCTGTTCATCATAAGCACTTTCTCGAGAAAGTGCTTATGATGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-2185s1c1
Sequence:CCGGCGGATATGAGAATCCAACTTACTCGAGTAAGTTGGATTCTCATATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-848s1c1
Sequence:CCGGGCTGATGTTGAGGAAGAGGAACTCGAGTTCCTCTTCCTCAACATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-1583s1c1
Sequence:CCGGGCTGAGGAGATTCAAGATGAACTCGAGTTCATCTTGAATCTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-491s1c1
Sequence:CCGGCGTTGCCTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAGGCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-2185s21c1
Sequence:CCGGCGGATATGAGAATCCAACTTACTCGAGTAAGTTGGATTCTCATATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007471
APP MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007471.2-2948s21c1
Sequence:CCGGCCTGTTCATCATAAGCACTTTCTCGAGAAAGTGCTTATGATGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-491s21c1
Sequence:CCGGCGTTGCCTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAGGCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-1583s21c1
Sequence:CCGGGCTGAGGAGATTCAAGATGAACTCGAGTTCATCTTGAATCTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007471.2-2948s1c1
Sequence:CCGGCCTGTTCATCATAAGCACTTTCTCGAGAAAGTGCTTATGATGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-2185s1c1
Sequence:CCGGCGGATATGAGAATCCAACTTACTCGAGTAAGTTGGATTCTCATATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-848s1c1
Sequence:CCGGGCTGATGTTGAGGAAGAGGAACTCGAGTTCCTCTTCCTCAACATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-1583s1c1
Sequence:CCGGGCTGAGGAGATTCAAGATGAACTCGAGTTCATCTTGAATCTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-491s1c1
Sequence:CCGGCGTTGCCTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAGGCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-2185s21c1
Sequence:CCGGCGGATATGAGAATCCAACTTACTCGAGTAAGTTGGATTCTCATATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007471
APP MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007471.2-2948s21c1
Sequence:CCGGCCTGTTCATCATAAGCACTTTCTCGAGAAAGTGCTTATGATGAACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000301473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-491s21c1
Sequence:CCGGCGTTGCCTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAGGCAACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000301470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-1583s21c1
Sequence:CCGGGCTGAGGAGATTCAAGATGAACTCGAGTTCATCTTGAATCTCCTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007471.2-2948s1c1
Sequence:CCGGCCTGTTCATCATAAGCACTTTCTCGAGAAAGTGCTTATGATGAACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-2185s1c1
Sequence:CCGGCGGATATGAGAATCCAACTTACTCGAGTAAGTTGGATTCTCATATCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-848s1c1
Sequence:CCGGGCTGATGTTGAGGAAGAGGAACTCGAGTTCCTCTTCCTCAACATCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-1583s1c1
Sequence:CCGGGCTGAGGAGATTCAAGATGAACTCGAGTTCATCTTGAATCTCCTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007471.2-491s1c1
Sequence:CCGGCGTTGCCTAGTTGGTGAGTTTCTCGAGAAACTCACCAACTAGGCAACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000301472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007471.2-2185s21c1
Sequence:CCGGCGGATATGAGAATCCAACTTACTCGAGTAAGTTGGATTCTCATATCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???