EMAIL THIS PAGE TO A FRIEND

ARFGAP2

ADP-ribosylation factor GTPase activating protein 2

156 Gene Product Result for
Synonyms: IRZ NBLA10535 ZFP289 ZNF289
UniProtKB ID: Q8N6H7, D3DQQ9, Q3LIF2, Q8N3I1, Q96SX7
Gene ID:
Mouse(77038) ADP-ribosylation factor GTPase activating protein 2
Rat(362162) ADP-ribosylation factor GTPase activating protein 2
sheep(101119250) ADP-ribosylation factor GTPase activating protein 2
naked mole-rat(101717089) ADP-ribosylation factor GTPase activating protein 2
domestic guinea pig(100723345) ADP-ribosylation factor GTPase activating protein 2
Zebrafish(641490) ADP-ribosylation factor GTPase activating protein 2
chicken(423187) ADP-ribosylation factor GTPase activating protein 2
domestic cat(101091559) ADP-ribosylation factor GTPase activating protein 2
cow(505438) ADP-ribosylation factor GTPase activating protein 2
Horse(100051105) ADP-ribosylation factor GTPase activating protein 2
dog(483627) ADP-ribosylation factor GTPase activating protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032389 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023854 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023854 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023854 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032389 Rosetta Predictions human pricing
NM_001033707 Rosetta Predictions rat pricing
NM_023854 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240356 predicted 460
2 SASI_Hs01_00240357 predicted 938
3 SASI_Hs01_00240358 predicted 760
4 SASI_Hs01_00240361 predicted 979
5 SASI_Hs01_00240362 predicted 1146
6 SASI_Hs02_00359786 predicted 455
7 SASI_Hs01_00240363 predicted 424
8 SASI_Hs01_00240364 predicted 920
9 SASI_Hs02_00359787 predicted 400
10 SASI_Hs01_00240365 predicted 417
11 SASI_Hs01_00240359 predicted 452
12 SASI_Hs01_00240360 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097719 predicted 340
2 SASI_Rn01_00097720 predicted 402
3 SASI_Rn01_00097721 predicted 1072
4 SASI_Rn01_00097722 predicted 388
5 SASI_Rn01_00097723 predicted 1485
6 SASI_Rn01_00097724 predicted 740
7 SASI_Rn01_00097725 predicted 208
8 SASI_Rn01_00097726 predicted 1001
9 SASI_Rn01_00097727 predicted 1053
10 SASI_Rn01_00097728 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057237 predicted 1044
2 SASI_Mm01_00057238 predicted 774
3 SASI_Mm01_00057239 predicted 521
4 SASI_Mm01_00057240 predicted 377
5 SASI_Mm02_00327405 predicted 322
6 SASI_Mm01_00057241 predicted 712
7 SASI_Mm01_00057242 predicted 366
8 SASI_Mm01_00057243 predicted 202
9 SASI_Mm01_00057244 predicted 1205
10 SASI_Mm01_00057245 predicted 981
11 SASI_Mm01_00057246 predicted 1038
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032389
VALIDATED
ARFGAP2 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor GTPase activating protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032389.2-1056s1c1
Sequence:CCGGGTTTGACGATGTTGGTACTTTCTCGAGAAAGTACCAACATCGTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032389.2-1314s1c1
Sequence:CCGGCATCTCATCTGACATGTTCTTCTCGAGAAGAACATGTCAGATGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032389.2-1308s1c1
Sequence:CCGGCAAAGCCATCTCATCTGACATCTCGAGATGTCAGATGAGATGGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032389.3-2307s21c1
Sequence:CCGGGACCCTCTGTGACATTCTTTACTCGAGTAAAGAATGTCACAGAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032389.3-315s21c1
Sequence:CCGGTGATGCCAACACCAAATATAACTCGAGTTATATTTGGTGTTGGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032389.3-1048s21c1
Sequence:CCGGTTTGACGATGTTGGTACTTTCCTCGAGGAAAGTACCAACATCGTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032389.3-1473s21c1
Sequence:CCGGAGCGGACATTGCCCAGTTTAACTCGAGTTAAACTGGGCAATGTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032389.3-1194s21c1
Sequence:CCGGCTCAAGCATCCGGCCTATTTCCTCGAGGAAATAGGCCGGATGCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032389
VALIDATED
ARFGAP2 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor GTPase activating protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032389.2-1056s1c1
Sequence:CCGGGTTTGACGATGTTGGTACTTTCTCGAGAAAGTACCAACATCGTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032389.2-1314s1c1
Sequence:CCGGCATCTCATCTGACATGTTCTTCTCGAGAAGAACATGTCAGATGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032389.2-1308s1c1
Sequence:CCGGCAAAGCCATCTCATCTGACATCTCGAGATGTCAGATGAGATGGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032389.3-2307s21c1
Sequence:CCGGGACCCTCTGTGACATTCTTTACTCGAGTAAAGAATGTCACAGAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032389.3-315s21c1
Sequence:CCGGTGATGCCAACACCAAATATAACTCGAGTTATATTTGGTGTTGGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032389.3-1048s21c1
Sequence:CCGGTTTGACGATGTTGGTACTTTCCTCGAGGAAAGTACCAACATCGTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032389.3-1473s21c1
Sequence:CCGGAGCGGACATTGCCCAGTTTAACTCGAGTTAAACTGGGCAATGTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032389.3-1194s21c1
Sequence:CCGGCTCAAGCATCCGGCCTATTTCCTCGAGGAAATAGGCCGGATGCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032389
VALIDATED
ARFGAP2 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor GTPase activating protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032389.2-1056s1c1
Sequence:CCGGGTTTGACGATGTTGGTACTTTCTCGAGAAAGTACCAACATCGTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032389.2-1314s1c1
Sequence:CCGGCATCTCATCTGACATGTTCTTCTCGAGAAGAACATGTCAGATGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032389.2-1308s1c1
Sequence:CCGGCAAAGCCATCTCATCTGACATCTCGAGATGTCAGATGAGATGGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032389.3-2307s21c1
Sequence:CCGGGACCCTCTGTGACATTCTTTACTCGAGTAAAGAATGTCACAGAGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032389.3-315s21c1
Sequence:CCGGTGATGCCAACACCAAATATAACTCGAGTTATATTTGGTGTTGGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032389.3-1048s21c1
Sequence:CCGGTTTGACGATGTTGGTACTTTCCTCGAGGAAAGTACCAACATCGTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032389.3-1473s21c1
Sequence:CCGGAGCGGACATTGCCCAGTTTAACTCGAGTTAAACTGGGCAATGTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032389.3-1194s21c1
Sequence:CCGGCTCAAGCATCCGGCCTATTTCCTCGAGGAAATAGGCCGGATGCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023854
VALIDATED
ARFGAP2 MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor GTPase activating protein 2
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023854.1-2128s1c1
Sequence:CCGGGCTCACCAAGAGCTAGAACTTCTCGAGAAGTTCTAGCTCTTGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023854.1-137s1c1
Sequence:CCGGCCAGCATCACTTACGGTGTATCTCGAGATACACCGTAAGTGATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023854.1-464s1c1
Sequence:CCGGCAGAGAAGAAAGACTCTGATTCTCGAGAATCAGAGTCTTTCTTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023854.1-1494s1c1
Sequence:CCGGCCAGTTTAAGCAGGGTGTCAACTCGAGTTGACACCCTGCTTAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023854.1-463s1c1
Sequence:CCGGCCAGAGAAGAAAGACTCTGATCTCGAGATCAGAGTCTTTCTTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023854.1-1945s21c1
Sequence:CCGGTGCAGGCTCTAGGATCCTTGTCTCGAGACAAGGATCCTAGAGCCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023854.1-1162s21c1
Sequence:CCGGGGTATGGACAGGGTAGAAGAGCTCGAGCTCTTCTACCCTGTCCATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023854.1-2031s21c1
Sequence:CCGGTATCAGCCCTCAGGGAGAAGTCTCGAGACTTCTCCCTGAGGGCTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023854.1-1801s21c1
Sequence:CCGGCTCTCCCTCCATGCTAGTGTTCTCGAGAACACTAGCATGGAGGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023854.1-1883s21c1
Sequence:CCGGAGCTCCATCAGGATGGCTTTACTCGAGTAAAGCCATCCTGATGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023854.1-1954s21c1
Sequence:CCGGTAGGATCCTTGTAGGTGGTCTCTCGAGAGACCACCTACAAGGATCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023854.1-1202s21c1
Sequence:CCGGTCTCCAGCATCCGGCCTATTTCTCGAGAAATAGGCCGGATGCTGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023854.1-326s21c1
Sequence:CCGGATGATGCTAACACCAAATATACTCGAGTATATTTGGTGTTAGCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023854.1-139s21c1
Sequence:CCGGAGCATCACTTACGGTGTATTTCTCGAGAAATACACCGTAAGTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023854.1-68s21c1
Sequence:CCGGTTAAGAGACTTCGCGCAATTCCTCGAGGAATTGCGCGAAGTCTCTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023854.1-1893s21c1
Sequence:CCGGGGATGGCTTTATGGATCTAATCTCGAGATTAGATCCATAAAGCCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023854
VALIDATED
ARFGAP2 MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor GTPase activating protein 2
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023854.1-2128s1c1
Sequence:CCGGGCTCACCAAGAGCTAGAACTTCTCGAGAAGTTCTAGCTCTTGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023854.1-137s1c1
Sequence:CCGGCCAGCATCACTTACGGTGTATCTCGAGATACACCGTAAGTGATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023854.1-464s1c1
Sequence:CCGGCAGAGAAGAAAGACTCTGATTCTCGAGAATCAGAGTCTTTCTTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023854.1-1494s1c1
Sequence:CCGGCCAGTTTAAGCAGGGTGTCAACTCGAGTTGACACCCTGCTTAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023854.1-463s1c1
Sequence:CCGGCCAGAGAAGAAAGACTCTGATCTCGAGATCAGAGTCTTTCTTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023854.1-1945s21c1
Sequence:CCGGTGCAGGCTCTAGGATCCTTGTCTCGAGACAAGGATCCTAGAGCCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023854.1-1162s21c1
Sequence:CCGGGGTATGGACAGGGTAGAAGAGCTCGAGCTCTTCTACCCTGTCCATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023854.1-2031s21c1
Sequence:CCGGTATCAGCCCTCAGGGAGAAGTCTCGAGACTTCTCCCTGAGGGCTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023854.1-1801s21c1
Sequence:CCGGCTCTCCCTCCATGCTAGTGTTCTCGAGAACACTAGCATGGAGGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023854.1-1883s21c1
Sequence:CCGGAGCTCCATCAGGATGGCTTTACTCGAGTAAAGCCATCCTGATGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023854.1-1954s21c1
Sequence:CCGGTAGGATCCTTGTAGGTGGTCTCTCGAGAGACCACCTACAAGGATCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023854.1-1202s21c1
Sequence:CCGGTCTCCAGCATCCGGCCTATTTCTCGAGAAATAGGCCGGATGCTGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023854.1-326s21c1
Sequence:CCGGATGATGCTAACACCAAATATACTCGAGTATATTTGGTGTTAGCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023854.1-139s21c1
Sequence:CCGGAGCATCACTTACGGTGTATTTCTCGAGAAATACACCGTAAGTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023854.1-68s21c1
Sequence:CCGGTTAAGAGACTTCGCGCAATTCCTCGAGGAATTGCGCGAAGTCTCTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023854.1-1893s21c1
Sequence:CCGGGGATGGCTTTATGGATCTAATCTCGAGATTAGATCCATAAAGCCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023854
VALIDATED
ARFGAP2 MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor GTPase activating protein 2
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023854.1-2128s1c1
Sequence:CCGGGCTCACCAAGAGCTAGAACTTCTCGAGAAGTTCTAGCTCTTGGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023854.1-137s1c1
Sequence:CCGGCCAGCATCACTTACGGTGTATCTCGAGATACACCGTAAGTGATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023854.1-464s1c1
Sequence:CCGGCAGAGAAGAAAGACTCTGATTCTCGAGAATCAGAGTCTTTCTTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023854.1-1494s1c1
Sequence:CCGGCCAGTTTAAGCAGGGTGTCAACTCGAGTTGACACCCTGCTTAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023854.1-463s1c1
Sequence:CCGGCCAGAGAAGAAAGACTCTGATCTCGAGATCAGAGTCTTTCTTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023854.1-1945s21c1
Sequence:CCGGTGCAGGCTCTAGGATCCTTGTCTCGAGACAAGGATCCTAGAGCCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023854.1-1162s21c1
Sequence:CCGGGGTATGGACAGGGTAGAAGAGCTCGAGCTCTTCTACCCTGTCCATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023854.1-2031s21c1
Sequence:CCGGTATCAGCCCTCAGGGAGAAGTCTCGAGACTTCTCCCTGAGGGCTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023854.1-1801s21c1
Sequence:CCGGCTCTCCCTCCATGCTAGTGTTCTCGAGAACACTAGCATGGAGGGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023854.1-1883s21c1
Sequence:CCGGAGCTCCATCAGGATGGCTTTACTCGAGTAAAGCCATCCTGATGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023854.1-1954s21c1
Sequence:CCGGTAGGATCCTTGTAGGTGGTCTCTCGAGAGACCACCTACAAGGATCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023854.1-1202s21c1
Sequence:CCGGTCTCCAGCATCCGGCCTATTTCTCGAGAAATAGGCCGGATGCTGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023854.1-326s21c1
Sequence:CCGGATGATGCTAACACCAAATATACTCGAGTATATTTGGTGTTAGCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023854.1-139s21c1
Sequence:CCGGAGCATCACTTACGGTGTATTTCTCGAGAAATACACCGTAAGTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023854.1-68s21c1
Sequence:CCGGTTAAGAGACTTCGCGCAATTCCTCGAGGAATTGCGCGAAGTCTCTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233445    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023854.1-1893s21c1
Sequence:CCGGGGATGGCTTTATGGATCTAATCTCGAGATTAGATCCATAAAGCCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)