EMAIL THIS PAGE TO A FRIEND

ARG1

arginase 1

70 Gene Product Result for
UniProtKB ID: P05089, A6NEA0, Q5JWT5, Q5JWT6, Q8TE72, Q9BS50
Gene ID:
Human(383) Summary: Arginase catalyzes the hydrolysis of arginine to ornithine and urea. At least two isoforms of mammalian arginase exist (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function. The type I isoform encoded by this gene, is a cytosolic enzyme and expressed predominantly in the liver as a component of the urea cycle. Inherited deficiency of this enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(11846) arginase, liver
Rat(29221) arginase, liver
Zebrafish(570368) arginase, liver
Thale Cress(843166) DnaJ-like protein ARG1
dog(474823) arginase, liver
cow(513608) arginase, liver
domestic cat(101089865) arginase, liver
Goat(100860853) arginase, liver
Domestic Rabbit(100008814) arginase, liver
sheep(101122363) arginase, liver
naked mole-rat(101703947) arginase, liver
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108591 Anti-ARG1 IgG fraction of antiserum rat, goat, horse, bovine, dog, human, pig
immunohistochemistry, western blot pricing
A6107 Anti-ARG1 (307-322) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV45672 Anti-ARG1 (AB1) antibody produced in rabbit IgG fraction of antiserum canine, guinea pig, rabbit, bovine, rat, rabbit, pig, human, mouse, horse
immunohistochemistry, western blot pricing
AV45673 Anti-ARG1 (AB2) antibody produced in rabbit IgG fraction of antiserum dog, human
immunohistochemistry, western blot pricing
SAB2501375 Anti-ARG1 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, pig, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB1405480 Anti-ARG1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2108087 Anti-ARG1 antibody produced in rabbit affinity isolated antibody goat, rabbit, dog, human, rat, bovine, horse, mouse, pig
immunohistochemistry, western blot pricing
HPA003595 Anti-ARG1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
HPA024006 Anti-ARG1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB2100144 Anti-ARG1 antibody produced in rabbit affinity isolated antibody, lyophilized powder rabbit, human, pig, horse, rat, mouse, yeast, bovine, rabbit
western blot pricing
SAB4200510 Anti-ARG1 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody mouse, rat, human
immunoprecipitation (IP), western blot pricing
SAB2500100 Anti-Arginase, Type 1/ARG1 (AB1) antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, human
ELISA, western blot pricing
SAB2500101 Anti-Arginase, Type 1/ARG1 (AB2) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat
ELISA, western blot pricing
SAB5500008 Anti-Arginase-1 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP156, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB4200508 Monoclonal Anti-ARG1 antibody produced in mouse ~1.0 mg/mL, clone ARG1-3, purified immunoglobulin rat, mouse, human
western blot pricing
SAB4100251 Monoclonal Anti-ARG1 antibody produced in mouse clone ARG1-A219, culture supernatant human
western blot pricing
SAB4200509 Monoclonal Anti-ARG1 antibody produced in mouse ~1.0 mg/mL, clone ARG1-6, purified immunoglobulin human
immunoprecipitation (IP), western blot pricing
AMAB90545 Monoclonal Anti-ARG1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0186, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

Kits

Product # Description Species Add to Cart
 
MAK112 Arginase Activity Assay Kit sufficient for 200 colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007482 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007482 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007482 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000045 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000045 Rosetta Predictions human pricing
NM_017134 Rosetta Predictions rat pricing
NM_007482 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152523 predicted 766
2 SASI_Hs01_00152524 predicted 485
3 SASI_Hs01_00152525 predicted 358
4 SASI_Hs01_00152526 predicted 871
5 SASI_Hs01_00152527 predicted 479
6 SASI_Hs01_00152529 predicted 917
7 SASI_Hs01_00152530 predicted 701
8 SASI_Hs01_00152531 predicted 568
9 SASI_Hs01_00152532 predicted 934
10 SASI_Hs02_00301737 predicted 983
11 SASI_Hs01_00152528 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093062 predicted 367
2 SASI_Rn01_00093063 predicted 1020
3 SASI_Rn01_00093064 predicted 652
4 SASI_Rn01_00093065 predicted 336
5 SASI_Rn01_00093066 predicted 1190
6 SASI_Rn01_00093067 predicted 873
7 SASI_Rn01_00093068 predicted 879
8 SASI_Rn01_00093069 predicted 1022
9 SASI_Rn01_00093071 predicted 985
10 SASI_Rn02_00261374 predicted 1024
11 SASI_Rn01_00093070 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007482 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311750 predicted 558
2 SASI_Mm01_00152998 predicted 509
3 SASI_Mm01_00152999 predicted 216
4 SASI_Mm01_00153000 predicted 257
5 SASI_Mm01_00153001 predicted 616
6 SASI_Mm01_00153002 predicted 629
7 SASI_Mm01_00153003 predicted 373
8 SASI_Mm01_00153004 predicted 393
9 SASI_Mm01_00153005 predicted 842
10 SASI_Mm02_00311751 predicted 930
11 SASI_Mm01_00152997 predicted 757
12 SASI_Mm01_00153006 predicted 338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007482
ARG1 MISSION shRNA Bacterial Glycerol Stock
arginase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007482.2-239s1c1
Sequence:CCGGGCCTTTGTTGATGTCCCTAATCTCGAGATTAGGGACATCAACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007482.2-1187s1c1
Sequence:CCGGGCAGTTCCTTTCTGGTATGAACTCGAGTTCATACCAGAAAGGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007482.2-1019s1c1
Sequence:CCGGCCAGGGACTGACTACCTTAAACTCGAGTTTAAGGTAGTCAGTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007482.2-850s1c1
Sequence:CCGGTCTCTACATCACAGAAGAAATCTCGAGATTTCTTCTGTGATGTAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007482.2-590s1c1
Sequence:CCGGGCCAAAGACATCGTGTACATTCTCGAGAATGTACACGATGTCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007482
ARG1 MISSION shRNA shRNA Plasmid DNA
arginase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007482.2-239s1c1
Sequence:CCGGGCCTTTGTTGATGTCCCTAATCTCGAGATTAGGGACATCAACAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007482.2-1187s1c1
Sequence:CCGGGCAGTTCCTTTCTGGTATGAACTCGAGTTCATACCAGAAAGGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007482.2-1019s1c1
Sequence:CCGGCCAGGGACTGACTACCTTAAACTCGAGTTTAAGGTAGTCAGTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007482.2-850s1c1
Sequence:CCGGTCTCTACATCACAGAAGAAATCTCGAGATTTCTTCTGTGATGTAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007482.2-590s1c1
Sequence:CCGGGCCAAAGACATCGTGTACATTCTCGAGAATGTACACGATGTCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007482
ARG1 MISSION shRNA Lentiviral Transduction Particles
arginase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007482.2-239s1c1
Sequence:CCGGGCCTTTGTTGATGTCCCTAATCTCGAGATTAGGGACATCAACAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007482.2-1187s1c1
Sequence:CCGGGCAGTTCCTTTCTGGTATGAACTCGAGTTCATACCAGAAAGGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007482.2-1019s1c1
Sequence:CCGGCCAGGGACTGACTACCTTAAACTCGAGTTTAAGGTAGTCAGTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007482.2-850s1c1
Sequence:CCGGTCTCTACATCACAGAAGAAATCTCGAGATTTCTTCTGTGATGTAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007482.2-590s1c1
Sequence:CCGGGCCAAAGACATCGTGTACATTCTCGAGAATGTACACGATGTCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000045
ARG1 MISSION shRNA Bacterial Glycerol Stock
arginase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000045.2-158s1c1
Sequence:CCGGGCTGGTCTGCTTGAGAAACTTCTCGAGAAGTTTCTCAAGCAGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000045.2-558s1c1
Sequence:CCGGCCTGTATATCTGCCAAGGATACTCGAGTATCCTTGGCAGATATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000045.2-994s1c1
Sequence:CCGGCAAGCCTATTGACTACCTTAACTCGAGTTAAGGTAGTCAATAGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000045.2-862s1c1
Sequence:CCGGGCTACTCTCAGGATTAGATATCTCGAGATATCTAATCCTGAGAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000045.2-478s1c1
Sequence:CCGGGCATGGACAACCTGTATCTTTCTCGAGAAAGATACAGGTTGTCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000045.2-354s21c1
Sequence:CCCGGAGACCACAGTTTGGCAATTGCTCGAGCAATTGCCAAACTGTGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000045.2-1051s21c1
Sequence:CCGGCTCATAGTTAATGGCATAATTCTCGAGAATTATGCCATTAACTATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000045.2-1094s21c1
Sequence:CCGGGCATAGAGTTATCCTTCTAAACTCGAGTTTAGAAGGATAACTCTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000045
ARG1 MISSION shRNA shRNA Plasmid DNA
arginase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000045.2-158s1c1
Sequence:CCGGGCTGGTCTGCTTGAGAAACTTCTCGAGAAGTTTCTCAAGCAGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000045.2-558s1c1
Sequence:CCGGCCTGTATATCTGCCAAGGATACTCGAGTATCCTTGGCAGATATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000045.2-994s1c1
Sequence:CCGGCAAGCCTATTGACTACCTTAACTCGAGTTAAGGTAGTCAATAGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000045.2-862s1c1
Sequence:CCGGGCTACTCTCAGGATTAGATATCTCGAGATATCTAATCCTGAGAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000045.2-478s1c1
Sequence:CCGGGCATGGACAACCTGTATCTTTCTCGAGAAAGATACAGGTTGTCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000045.2-354s21c1
Sequence:CCCGGAGACCACAGTTTGGCAATTGCTCGAGCAATTGCCAAACTGTGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000045.2-1051s21c1
Sequence:CCGGCTCATAGTTAATGGCATAATTCTCGAGAATTATGCCATTAACTATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000045.2-1094s21c1
Sequence:CCGGGCATAGAGTTATCCTTCTAAACTCGAGTTTAGAAGGATAACTCTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000045
ARG1 MISSION shRNA Lentiviral Transduction Particles
arginase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000045.2-158s1c1
Sequence:CCGGGCTGGTCTGCTTGAGAAACTTCTCGAGAAGTTTCTCAAGCAGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000045.2-558s1c1
Sequence:CCGGCCTGTATATCTGCCAAGGATACTCGAGTATCCTTGGCAGATATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000045.2-994s1c1
Sequence:CCGGCAAGCCTATTGACTACCTTAACTCGAGTTAAGGTAGTCAATAGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000045.2-862s1c1
Sequence:CCGGGCTACTCTCAGGATTAGATATCTCGAGATATCTAATCCTGAGAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000045.2-478s1c1
Sequence:CCGGGCATGGACAACCTGTATCTTTCTCGAGAAAGATACAGGTTGTCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000045.2-354s21c1
Sequence:CCCGGAGACCACAGTTTGGCAATTGCTCGAGCAATTGCCAAACTGTGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000045.2-1051s21c1
Sequence:CCGGCTCATAGTTAATGGCATAATTCTCGAGAATTATGCCATTAACTATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000045.2-1094s21c1
Sequence:CCGGGCATAGAGTTATCCTTCTAAACTCGAGTTTAGAAGGATAACTCTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)