EMAIL THIS PAGE TO A FRIEND

ARHGEF12

Rho guanine nucleotide exchange factor (GEF) 12

179 Gene Product Result for
Synonyms: LARG PRO2792
UniProtKB ID: Q9NZN5, O15086, Q6P526
Gene ID:
Human(23365) Summary: Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Mouse(69632) Rho guanine nucleotide exchange factor (GEF) 12
Rat(367072) Rho guanine nucleotide exchange factor (GEF) 12
Zebrafish(571031) Rho guanine nucleotide exchange factor (GEF) 12
cow(503575) Rho guanine nucleotide exchange factor (GEF) 12
domestic cat(101085657) Rho guanine nucleotide exchange factor (GEF) 12
dog(479409) Rho guanine nucleotide exchange factor (GEF) 12
chicken(419752) Rho guanine nucleotide exchange factor (GEF) 12
domestic guinea pig(100723937) Rho guanine nucleotide exchange factor (GEF) 12
naked mole-rat(101716885) Rho guanine nucleotide exchange factor (GEF) 12
sheep(101117190) Rho guanine nucleotide exchange factor (GEF) 12
Domestic Rabbit(100340118) Rho guanine nucleotide exchange factor (GEF) 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027144 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027144 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027144 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015313 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122711 MISSION® esiRNA esiRNA human ARHGEF12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015313 Rosetta Predictions human pricing
NM_001013246 Rosetta Predictions rat pricing
NM_027144 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072073 predicted 3197
2 SASI_Hs02_00347574 predicted 333
3 SASI_Hs02_00347575 predicted 3963
4 SASI_Hs01_00072077 predicted 1202
5 SASI_Hs02_00347576 predicted 407
6 SASI_Hs01_00072078 predicted 1483
7 SASI_Hs02_00347577 predicted 3307
8 SASI_Hs01_00072079 predicted 3603
9 SASI_Hs01_00072080 predicted 1169
10 SASI_Hs02_00347578 predicted 1096
11 SASI_Hs01_00072074 predicted 1838
12 SASI_Hs01_00072075 predicted 2383
13 SASI_Hs01_00072076 predicted 808
14 SASI_Hs01_00072081 predicted 1217
15 SASI_Hs01_00072082 predicted 4228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201071 predicted 2986
2 SASI_Rn01_00092127 predicted 2427
3 SASI_Rn01_00092128 predicted 3301
4 SASI_Rn01_00092129 predicted 326
5 SASI_Rn01_00092130 predicted 2364
6 SASI_Rn01_00092131 predicted 489
7 SASI_Rn01_00092132 predicted 271
8 SASI_Rn01_00092133 predicted 1676
9 SASI_Rn01_00092134 predicted 3762
10 SASI_Rn01_00092135 predicted 318
11 SASI_Rn01_00092136 predicted 1753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027144 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331643 predicted 4047
2 SASI_Mm02_00331644 predicted 838
3 SASI_Mm01_00106867 predicted 3813
4 SASI_Mm01_00106868 predicted 4717
5 SASI_Mm01_00106869 predicted 3485
6 SASI_Mm02_00331645 predicted 777
7 SASI_Mm01_00106872 predicted 2193
8 SASI_Mm01_00106873 predicted 998
9 SASI_Mm01_00106874 predicted 4264
10 SASI_Mm02_00331646 predicted 3015
11 SASI_Mm01_00106870 predicted 2642
12 SASI_Mm01_00106871 predicted 2708
13 SASI_Mm01_00106875 predicted 749
14 SASI_Mm01_00106876 predicted 507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027144
VALIDATED
ARHGEF12 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027144.2-5492s21c1
Sequence:CCGGCCGTATTTGAAAGCACACTTTCTCGAGAAAGTGTGCTTTCAAATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027144.2-2066s21c1
Sequence:CCGGGCGGAACAGATCGTTACCAAACTCGAGTTTGGTAACGATCTGTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027144.2-994s21c1
Sequence:CCGGGCCATCAGTCACTGGACATATCTCGAGATATGTCCAGTGACTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027144.2-2143s21c1
Sequence:CCGGGCAGTATGTAATTCTCATGTACTCGAGTACATGAGAATTACATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027144.2-4085s21c1
Sequence:CCGGCCTCAGTCTCATTCACTGAATCTCGAGATTCAGTGAATGAGACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027144.1-5254s1c1
Sequence:CCGGCCGTATTTGAAAGCACACTTTCTCGAGAAAGTGTGCTTTCAAATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027144.1-1828s1c1
Sequence:CCGGGCGGAACAGATCGTTACCAAACTCGAGTTTGGTAACGATCTGTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027144.1-3847s1c1
Sequence:CCGGCCTCAGTCTCATTCACTGAATCTCGAGATTCAGTGAATGAGACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027144.1-1905s1c1
Sequence:CCGGGCAGTATGTAATTCTCATGTACTCGAGTACATGAGAATTACATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027144.1-759s1c1
Sequence:CCGGGCCATCAGTCACTGGACATATCTCGAGATATGTCCAGTGACTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027144
VALIDATED
ARHGEF12 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027144.2-5492s21c1
Sequence:CCGGCCGTATTTGAAAGCACACTTTCTCGAGAAAGTGTGCTTTCAAATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027144.2-2066s21c1
Sequence:CCGGGCGGAACAGATCGTTACCAAACTCGAGTTTGGTAACGATCTGTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027144.2-994s21c1
Sequence:CCGGGCCATCAGTCACTGGACATATCTCGAGATATGTCCAGTGACTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027144.2-2143s21c1
Sequence:CCGGGCAGTATGTAATTCTCATGTACTCGAGTACATGAGAATTACATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027144.2-4085s21c1
Sequence:CCGGCCTCAGTCTCATTCACTGAATCTCGAGATTCAGTGAATGAGACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027144.1-5254s1c1
Sequence:CCGGCCGTATTTGAAAGCACACTTTCTCGAGAAAGTGTGCTTTCAAATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027144.1-1828s1c1
Sequence:CCGGGCGGAACAGATCGTTACCAAACTCGAGTTTGGTAACGATCTGTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027144.1-3847s1c1
Sequence:CCGGCCTCAGTCTCATTCACTGAATCTCGAGATTCAGTGAATGAGACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027144.1-1905s1c1
Sequence:CCGGGCAGTATGTAATTCTCATGTACTCGAGTACATGAGAATTACATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027144.1-759s1c1
Sequence:CCGGGCCATCAGTCACTGGACATATCTCGAGATATGTCCAGTGACTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027144
VALIDATED
ARHGEF12 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027144.2-5492s21c1
Sequence:CCGGCCGTATTTGAAAGCACACTTTCTCGAGAAAGTGTGCTTTCAAATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027144.2-2066s21c1
Sequence:CCGGGCGGAACAGATCGTTACCAAACTCGAGTTTGGTAACGATCTGTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027144.2-994s21c1
Sequence:CCGGGCCATCAGTCACTGGACATATCTCGAGATATGTCCAGTGACTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027144.2-2143s21c1
Sequence:CCGGGCAGTATGTAATTCTCATGTACTCGAGTACATGAGAATTACATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027144.2-4085s21c1
Sequence:CCGGCCTCAGTCTCATTCACTGAATCTCGAGATTCAGTGAATGAGACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027144.1-5254s1c1
Sequence:CCGGCCGTATTTGAAAGCACACTTTCTCGAGAAAGTGTGCTTTCAAATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027144.1-1828s1c1
Sequence:CCGGGCGGAACAGATCGTTACCAAACTCGAGTTTGGTAACGATCTGTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027144.1-3847s1c1
Sequence:CCGGCCTCAGTCTCATTCACTGAATCTCGAGATTCAGTGAATGAGACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027144.1-1905s1c1
Sequence:CCGGGCAGTATGTAATTCTCATGTACTCGAGTACATGAGAATTACATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027144.1-759s1c1
Sequence:CCGGGCCATCAGTCACTGGACATATCTCGAGATATGTCCAGTGACTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015313
VALIDATED
ARHGEF12 MISSION shRNA Bacterial Glycerol Stock
Rho guanine nucleotide exchange factor (GEF) 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015313.1-2452s21c1
Sequence:CCGGGCGAGTATCCAGAGAAGGAATCTCGAGATTCCTTCTCTGGATACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015313.1-1262s21c1
Sequence:CCGGCGTCGCATCTTCCTTGAGTTTCTCGAGAAACTCAAGGAAGATGCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015313.1-1427s21c1
Sequence:CCGGCCAGAAGTTCAAAGGCACTTACTCGAGTAAGTGCCTTTGAACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015313.1-2799s21c1
Sequence:CCGGCCACTCAAATGCAAAGGCTTACTCGAGTAAGCCTTTGCATTTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015313.1-217s21c1
Sequence:CCGGGCGTTGCGTAATCATCCAGAACTCGAGTTCTGGATGATTACGCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015313.1-1262s1c1
Sequence:CCGGCGTCGCATCTTCCTTGAGTTTCTCGAGAAACTCAAGGAAGATGCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015313.1-2799s1c1
Sequence:CCGGCCACTCAAATGCAAAGGCTTACTCGAGTAAGCCTTTGCATTTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015313.1-1427s1c1
Sequence:CCGGCCAGAAGTTCAAAGGCACTTACTCGAGTAAGTGCCTTTGAACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015313.1-2452s1c1
Sequence:CCGGGCGAGTATCCAGAGAAGGAATCTCGAGATTCCTTCTCTGGATACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015313.1-217s1c1
Sequence:CCGGGCGTTGCGTAATCATCCAGAACTCGAGTTCTGGATGATTACGCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015313
VALIDATED
ARHGEF12 MISSION shRNA shRNA Plasmid DNA
Rho guanine nucleotide exchange factor (GEF) 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015313.1-2452s21c1
Sequence:CCGGGCGAGTATCCAGAGAAGGAATCTCGAGATTCCTTCTCTGGATACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015313.1-1262s21c1
Sequence:CCGGCGTCGCATCTTCCTTGAGTTTCTCGAGAAACTCAAGGAAGATGCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015313.1-1427s21c1
Sequence:CCGGCCAGAAGTTCAAAGGCACTTACTCGAGTAAGTGCCTTTGAACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015313.1-2799s21c1
Sequence:CCGGCCACTCAAATGCAAAGGCTTACTCGAGTAAGCCTTTGCATTTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015313.1-217s21c1
Sequence:CCGGGCGTTGCGTAATCATCCAGAACTCGAGTTCTGGATGATTACGCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015313.1-1262s1c1
Sequence:CCGGCGTCGCATCTTCCTTGAGTTTCTCGAGAAACTCAAGGAAGATGCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015313.1-2799s1c1
Sequence:CCGGCCACTCAAATGCAAAGGCTTACTCGAGTAAGCCTTTGCATTTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015313.1-1427s1c1
Sequence:CCGGCCAGAAGTTCAAAGGCACTTACTCGAGTAAGTGCCTTTGAACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015313.1-2452s1c1
Sequence:CCGGGCGAGTATCCAGAGAAGGAATCTCGAGATTCCTTCTCTGGATACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015313.1-217s1c1
Sequence:CCGGGCGTTGCGTAATCATCCAGAACTCGAGTTCTGGATGATTACGCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015313
VALIDATED
ARHGEF12 MISSION shRNA Lentiviral Transduction Particles
Rho guanine nucleotide exchange factor (GEF) 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_015313.1-2452s21c1
Sequence:CCGGGCGAGTATCCAGAGAAGGAATCTCGAGATTCCTTCTCTGGATACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015313.1-1262s21c1
Sequence:CCGGCGTCGCATCTTCCTTGAGTTTCTCGAGAAACTCAAGGAAGATGCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_015313.1-1427s21c1
Sequence:CCGGCCAGAAGTTCAAAGGCACTTACTCGAGTAAGTGCCTTTGAACTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_015313.1-2799s21c1
Sequence:CCGGCCACTCAAATGCAAAGGCTTACTCGAGTAAGCCTTTGCATTTGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015313.1-217s21c1
Sequence:CCGGGCGTTGCGTAATCATCCAGAACTCGAGTTCTGGATGATTACGCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015313.1-1262s1c1
Sequence:CCGGCGTCGCATCTTCCTTGAGTTTCTCGAGAAACTCAAGGAAGATGCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015313.1-2799s1c1
Sequence:CCGGCCACTCAAATGCAAAGGCTTACTCGAGTAAGCCTTTGCATTTGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015313.1-1427s1c1
Sequence:CCGGCCAGAAGTTCAAAGGCACTTACTCGAGTAAGTGCCTTTGAACTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015313.1-2452s1c1
Sequence:CCGGGCGAGTATCCAGAGAAGGAATCTCGAGATTCCTTCTCTGGATACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015313.1-217s1c1
Sequence:CCGGGCGTTGCGTAATCATCCAGAACTCGAGTTCTGGATGATTACGCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)