EMAIL THIS PAGE TO A FRIEND

ARID4A

AT rich interactive domain 4A (RBP1-like)

246 Gene Product Result for
Synonyms: RBBP-1 RBBP1 RBP-1 RBP1
UniProtKB ID: P29374, Q15991, Q15992, Q15993
Gene ID:
Human(5926) Summary: The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein (pRB) which regulates cell proliferation. pRB represses transcription by recruiting the encoded protein. This protein, in turn, serves as a bridging molecule to recruit HDACs and, in addition, provides a second HDAC-independent repression function. The encoded protein possesses transcriptional repression activity. Multiple alternatively spliced transcripts have been observed for this gene, although not all transcript variants have been fully described. [provided by RefSeq, Jul 2008]
Mouse(238247) AT rich interactive domain 4A (RBP1-like)
Rat(314205) AT rich interactive domain 4A (Rbp1 like)
sheep(101122697) AT rich interactive domain 4A (RBP1-like)
Domestic Rabbit(100352701) AT rich interactive domain 4A (RBP1-like)
naked mole-rat(101705404) AT rich interactive domain 4A (RBP1-like)
domestic guinea pig(100729821) AT rich interactive domain 4A (RBP1-like)
Zebrafish(327404) AT rich interactive domain 4A (RBP1-like)
chicken(423541) AT rich interactive domain 4A (RBP1-like)
dog(480339) AT rich interactive domain 4A (RBP1-like)
domestic cat(101096240) AT rich interactive domain 4A (RBP1-like)
Horse(100051059) AT rich interactive domain 4A (RBP1-like)
cow(531515) AT rich interactive domain 4A (RBP1-like)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002892 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002892 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002892 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081195 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081195 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081195 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002892 Rosetta Predictions human pricing
NM_023000 Rosetta Predictions human pricing
NM_023001 Rosetta Predictions human pricing
NM_001108029 Rosetta Predictions rat pricing
NM_001081195 Rosetta Predictions mouse pricing
XM_354675 Rosetta Predictions mouse pricing
XM_898159 Rosetta Predictions mouse pricing
XM_898193 Rosetta Predictions mouse pricing
XM_898206 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133080 predicted 820
2 SASI_Hs01_00133082 predicted 833
3 SASI_Hs01_00133083 predicted 757
4 SASI_Hs01_00133084 predicted 482
5 SASI_Hs01_00133085 predicted 2858
6 SASI_Hs01_00133086 predicted 3113
7 SASI_Hs01_00133087 predicted 497
8 SASI_Hs02_00334694 predicted 1044
9 SASI_Hs02_00334695 predicted 3167
10 SASI_Hs02_00334696 predicted 3020
11 SASI_Hs01_00133081 predicted 2875
12 SASI_Hs01_00133088 predicted 1125
13 SASI_Hs01_00133089 predicted 3069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112514 predicted 814
2 SASI_Hs01_00112516 predicted 833
3 SASI_Hs01_00112517 predicted 759
4 SASI_Hs01_00112518 predicted 483
5 SASI_Hs01_00112519 predicted 2858
6 SASI_Hs01_00112520 predicted 3114
7 SASI_Hs01_00112521 predicted 502
8 SASI_Hs02_00356257 predicted 1044
9 SASI_Hs02_00356258 predicted 3171
10 SASI_Hs02_00356259 predicted 3018
11 SASI_Hs01_00112515 predicted 2875
12 SASI_Hs01_00112522 predicted 1127
13 SASI_Hs01_00112523 predicted 3067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125181 predicted 814
2 SASI_Hs01_00125183 predicted 827
3 SASI_Hs01_00125184 predicted 751
4 SASI_Hs01_00125185 predicted 478
5 SASI_Hs01_00125186 predicted 2857
6 SASI_Hs01_00125187 predicted 3111
7 SASI_Hs01_00125188 predicted 500
8 SASI_Hs02_00356260 predicted 1048
9 SASI_Hs02_00356261 predicted 3171
10 SASI_Hs02_00356262 predicted 3012
11 SASI_Hs01_00125182 predicted 2875
12 SASI_Hs01_00125189 predicted 1128
13 SASI_Hs01_00125190 predicted 3064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234665 predicted 2299
2 SASI_Rn02_00234666 predicted 2411
3 SASI_Rn02_00234667 predicted 3015
4 SASI_Rn02_00234668 predicted 2299
5 SASI_Rn02_00234669 predicted 2995
6 SASI_Rn02_00234670 predicted 2667
7 SASI_Rn02_00234671 predicted 2203
8 SASI_Rn02_00234672 predicted 3508
9 SASI_Rn02_00234673 predicted 2945
10 SASI_Rn02_00234674 predicted 2290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081195 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296121 predicted 471
2 SASI_Mm02_00296122 predicted 3117
3 SASI_Mm02_00296123 predicted 866
4 SASI_Mm02_00296124 predicted 412
5 SASI_Mm02_00296125 predicted 401
6 SASI_Mm02_00296126 predicted 1249
7 SASI_Mm02_00296127 predicted 485
8 SASI_Mm02_00296128 predicted 1044
9 SASI_Mm02_00296129 predicted 2439
10 SASI_Mm02_00296130 predicted 2580
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_354675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272117 predicted 476
2 SASI_Mm01_00272118 predicted 3128
3 SASI_Mm01_00272119 predicted 880
4 SASI_Mm01_00272120 predicted 404
5 SASI_Mm01_00272121 predicted 1262
6 SASI_Mm01_00272122 predicted 486
7 SASI_Mm01_00272123 predicted 2440
8 SASI_Mm01_00272124 predicted 2577
9 SASI_Mm01_00272125 predicted 465
10 SASI_Mm01_00272126 predicted 3970
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898159 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280223 predicted 475
2 SASI_Mm01_00280224 predicted 3122
3 SASI_Mm01_00280225 predicted 3509
4 SASI_Mm01_00280226 predicted 880
5 SASI_Mm01_00280227 predicted 411
6 SASI_Mm01_00280228 predicted 1260
7 SASI_Mm01_00280229 predicted 493
8 SASI_Mm01_00280230 predicted 1049
9 SASI_Mm01_00280231 predicted 2446
10 SASI_Mm01_00280232 predicted 3125
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251334 predicted 2209
2 SASI_Mm01_00251335 predicted 1551
3 SASI_Mm01_00251336 predicted 333
4 SASI_Mm01_00251337 predicted 1525
5 SASI_Mm01_00251338 predicted 2861
6 SASI_Mm01_00251339 predicted 2206
7 SASI_Mm01_00251340 predicted 1660
8 SASI_Mm01_00251341 predicted 3053
9 SASI_Mm01_00251342 predicted 2762
10 SASI_Mm01_00251343 predicted 2449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279479 predicted 444
2 SASI_Mm01_00279480 predicted 3085
3 SASI_Mm01_00279481 predicted 833
4 SASI_Mm01_00279482 predicted 374
5 SASI_Mm01_00279483 predicted 1216
6 SASI_Mm01_00279484 predicted 450
7 SASI_Mm01_00279485 predicted 2410
8 SASI_Mm01_00279486 predicted 2540
9 SASI_Mm01_00279487 predicted 426
10 SASI_Mm01_00279488 predicted 3938
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002892
VALIDATED
ARID4A MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 4A (RBP1-like)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002892.3-1448s21c1
Sequence:CCGGGTACTGCCGTTCGGCAAATATCTCGAGATATTTGCCGAACGGCAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002892.3-3482s21c1
Sequence:CCGGTGATGGAAATAGTGGATTAATCTCGAGATTAATCCACTATTTCCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002892.3-3330s21c1
Sequence:CCGGACGATTGAAGTTGATAGTATTCTCGAGAATACTATCAACTTCAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002892.2-4095s1c1
Sequence:CCGGCCTGCCATATTTGTCATAATTCTCGAGAATTATGACAAATATGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_002892.2-616s1c1
Sequence:CCGGCGCCGTCTCAATGATGAATTACTCGAGTAATTCATCATTGAGACGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002892.2-2136s1c1
Sequence:CCGGCCTCTCATCAAACATGCCGTACTCGAGTACGGCATGTTTGATGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002892.2-3248s1c1
Sequence:CCGGCGGCAAATGGATTTGAAACTACTCGAGTAGTTTCAAATCCATTTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002892.2-1405s1c1
Sequence:CCGGGCTCTCAAATTAGATCAAGAACTCGAGTTCTTGATCTAATTTGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002892
VALIDATED
ARID4A MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 4A (RBP1-like)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002892.3-1448s21c1
Sequence:CCGGGTACTGCCGTTCGGCAAATATCTCGAGATATTTGCCGAACGGCAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002892.3-3482s21c1
Sequence:CCGGTGATGGAAATAGTGGATTAATCTCGAGATTAATCCACTATTTCCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002892.3-3330s21c1
Sequence:CCGGACGATTGAAGTTGATAGTATTCTCGAGAATACTATCAACTTCAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002892.2-4095s1c1
Sequence:CCGGCCTGCCATATTTGTCATAATTCTCGAGAATTATGACAAATATGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_002892.2-616s1c1
Sequence:CCGGCGCCGTCTCAATGATGAATTACTCGAGTAATTCATCATTGAGACGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002892.2-2136s1c1
Sequence:CCGGCCTCTCATCAAACATGCCGTACTCGAGTACGGCATGTTTGATGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002892.2-3248s1c1
Sequence:CCGGCGGCAAATGGATTTGAAACTACTCGAGTAGTTTCAAATCCATTTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002892.2-1405s1c1
Sequence:CCGGGCTCTCAAATTAGATCAAGAACTCGAGTTCTTGATCTAATTTGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002892
VALIDATED
ARID4A MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 4A (RBP1-like)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002892.3-1448s21c1
Sequence:CCGGGTACTGCCGTTCGGCAAATATCTCGAGATATTTGCCGAACGGCAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002892.3-3482s21c1
Sequence:CCGGTGATGGAAATAGTGGATTAATCTCGAGATTAATCCACTATTTCCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002892.3-3330s21c1
Sequence:CCGGACGATTGAAGTTGATAGTATTCTCGAGAATACTATCAACTTCAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002892.2-4095s1c1
Sequence:CCGGCCTGCCATATTTGTCATAATTCTCGAGAATTATGACAAATATGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_002892.2-616s1c1
Sequence:CCGGCGCCGTCTCAATGATGAATTACTCGAGTAATTCATCATTGAGACGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002892.2-2136s1c1
Sequence:CCGGCCTCTCATCAAACATGCCGTACTCGAGTACGGCATGTTTGATGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_002892.2-3248s1c1
Sequence:CCGGCGGCAAATGGATTTGAAACTACTCGAGTAGTTTCAAATCCATTTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002892.2-1405s1c1
Sequence:CCGGGCTCTCAAATTAGATCAAGAACTCGAGTTCTTGATCTAATTTGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081195
VALIDATED
ARID4A MISSION shRNA Bacterial Glycerol Stock
AT rich interactive domain 4A (RBP1-like)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081195.1-750s21c1
Sequence:CCGGGGCGTCTCAATGACGAATTATCTCGAGATAATTCGTCATTGAGACGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081195.1-2093s21c1
Sequence:CCGGTACGGATGGAACGTCAGATATCTCGAGATATCTGACGTTCCATCCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081195.1-5265s21c1
Sequence:CCGGTTCGCTGTACTGCCGAATAAACTCGAGTTTATTCGGCAGTACAGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081195.1-466s21c1
Sequence:CCGGATCTATCCAGGAAGCTATTATCTCGAGATAATAGCTTCCTGGATAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081195.1-3296s21c1
Sequence:CCGGCAAGACGAGTCCCGAAGTATACTCGAGTATACTTCGGGACTCGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081195
VALIDATED
ARID4A MISSION shRNA shRNA Plasmid DNA
AT rich interactive domain 4A (RBP1-like)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081195.1-750s21c1
Sequence:CCGGGGCGTCTCAATGACGAATTATCTCGAGATAATTCGTCATTGAGACGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081195.1-2093s21c1
Sequence:CCGGTACGGATGGAACGTCAGATATCTCGAGATATCTGACGTTCCATCCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081195.1-5265s21c1
Sequence:CCGGTTCGCTGTACTGCCGAATAAACTCGAGTTTATTCGGCAGTACAGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081195.1-466s21c1
Sequence:CCGGATCTATCCAGGAAGCTATTATCTCGAGATAATAGCTTCCTGGATAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081195.1-3296s21c1
Sequence:CCGGCAAGACGAGTCCCGAAGTATACTCGAGTATACTTCGGGACTCGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081195
VALIDATED
ARID4A MISSION shRNA Lentiviral Transduction Particles
AT rich interactive domain 4A (RBP1-like)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081195.1-750s21c1
Sequence:CCGGGGCGTCTCAATGACGAATTATCTCGAGATAATTCGTCATTGAGACGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081195.1-2093s21c1
Sequence:CCGGTACGGATGGAACGTCAGATATCTCGAGATATCTGACGTTCCATCCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081195.1-5265s21c1
Sequence:CCGGTTCGCTGTACTGCCGAATAAACTCGAGTTTATTCGGCAGTACAGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081195.1-466s21c1
Sequence:CCGGATCTATCCAGGAAGCTATTATCTCGAGATAATAGCTTCCTGGATAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081195.1-3296s21c1
Sequence:CCGGCAAGACGAGTCCCGAAGTATACTCGAGTATACTTCGGGACTCGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)