EMAIL THIS PAGE TO A FRIEND

ARL5A

ADP-ribosylation factor-like 5A

107 Gene Product Result for
Synonyms: ARFLP5 ARL5
UniProtKB ID: Q9Y689, Q580I5
Gene ID:
Human(26225) Summary: The protein encoded by this gene belongs to the ARF family of GTP-binding proteins. With its distinctive nuclear/nucleolar localization and interaction with HP1alpha, the protein is developmentally regulated and may play a role(s) in nuclear dynamics and/or signaling cascades during embryonic development. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene has multiple pseudogenes. [provided by RefSeq, Jul 2008]
Mouse(75423) ADP-ribosylation factor-like 5A
Rat(117050) ADP-ribosylation factor-like 5A
Zebrafish(436611) ADP-ribosylation factor-like 5A
dog(100683961) ADP-ribosylation factor-like 5A
cow(519694) ADP-ribosylation factor-like 5A
domestic cat(101101325) ADP-ribosylation factor-like 5A
Goat(100861140) ADP-ribosylation factor-like 5A
sheep(100302313) ADP-ribosylation factor-like 5A
naked mole-rat(101725667) ADP-ribosylation factor-like 5A
domestic guinea pig(100727727) ADP-ribosylation factor-like 5A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177985 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177985 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177985 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182994 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182994 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182994 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115671 MISSION® esiRNA esiRNA human ARL5A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037174 Rosetta Predictions human pricing
NM_012097 Rosetta Predictions human pricing
NM_177985 Rosetta Predictions human pricing
NM_053979 Rosetta Predictions rat pricing
NM_182994 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019282 predicted 535
2 SASI_Hs01_00019283 predicted 598
3 SASI_Hs01_00019284 predicted 986
4 SASI_Hs01_00019285 predicted 571
5 SASI_Hs01_00019286 predicted 481
6 SASI_Hs01_00019287 predicted 437
7 SASI_Hs02_00308233 predicted 968
8 SASI_Hs01_00019288 predicted 966
9 SASI_Hs01_00019289 predicted 574
10 SASI_Hs01_00019290 predicted 366
11 SASI_Hs01_00019291 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197610 predicted 792
2 SASI_Hs01_00197611 predicted 854
3 SASI_Hs01_00197612 predicted 1238
4 SASI_Hs01_00197613 predicted 826
5 SASI_Hs01_00197614 predicted 744
6 SASI_Hs01_00197615 predicted 691
7 SASI_Hs02_00343602 predicted 1228
8 SASI_Hs01_00197616 predicted 1226
9 SASI_Hs01_00197617 predicted 830
10 SASI_Hs01_00197618 predicted 620
11 SASI_Hs01_00197619 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014695 predicted 534
2 SASI_Hs01_00014696 predicted 601
3 SASI_Hs01_00014697 predicted 976
4 SASI_Hs01_00014698 predicted 568
5 SASI_Hs01_00014699 predicted 481
6 SASI_Hs01_00014700 predicted 439
7 SASI_Hs02_00369457 predicted 967
8 SASI_Hs01_00014701 predicted 961
9 SASI_Hs01_00014702 predicted 569
10 SASI_Hs01_00014703 predicted 358
11 SASI_Hs01_00014704 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266966 predicted 378
2 SASI_Rn01_00057673 predicted 388
3 SASI_Rn01_00057674 predicted 466
4 SASI_Rn02_00266967 predicted 309
5 SASI_Rn02_00266968 predicted 478
6 SASI_Rn01_00057677 predicted 439
7 SASI_Rn02_00266969 predicted 340
8 SASI_Rn02_00266970 predicted 298
9 SASI_Rn02_00266971 predicted 271
10 SASI_Rn01_00057679 predicted 435
11 SASI_Rn01_00057672 predicted 1033
12 SASI_Rn01_00057675 predicted 1067
13 SASI_Rn01_00057676 predicted 849
14 SASI_Rn01_00057678 predicted 424
15 SASI_Rn01_00057680 predicted 387
16 SASI_Rn01_00057681 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182994 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034209 predicted 517
2 SASI_Mm01_00034210 predicted 489
3 SASI_Mm01_00034211 predicted 696
4 SASI_Mm01_00034212 predicted 235
5 SASI_Mm01_00034213 predicted 473
6 SASI_Mm01_00034214 predicted 274
7 SASI_Mm01_00034215 predicted 528
8 SASI_Mm01_00034217 predicted 441
9 SASI_Mm01_00034218 predicted 346
10 SASI_Mm02_00350003 predicted 1056
11 SASI_Mm01_00034216 predicted 482
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177985
VALIDATED
ARL5A MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 5A
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_177985.1-331s1c1
Sequence:CCGGGACAGAGAGAGGATTTCTGTACTCGAGTACAGAAATCCTCTCTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_177985.1-335s1c1
Sequence:CCGGGAGAGAGGATTTCTGTAACTACTCGAGTAGTTACAGAAATCCTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_177985.1-275s1c1
Sequence:CCGGCCTGGAACACTTACTATACTACTCGAGTAGTATAGTAAGTGTTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_177985.1-556s1c1
Sequence:CCGGGAATGGATGATGTCACGACTTCTCGAGAAGTCGTGACATCATCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177985.1-443s1c1
Sequence:CCGGGCATGACTGTAGCAGAAATCTCTCGAGAGATTTCTGCTACAGTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177985.1-254s1c1
Sequence:CCGGGCCAAGAATCTCTTCGTTCTTCTCGAGAAGAACGAAGAGATTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177985.1-754s1c1
Sequence:CCGGCCTTCCAGTTTGCTTTCTCATCTCGAGATGAGAAAGCAAACTGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177985.2-486s21c1
Sequence:GTACCGGTGAAGCTAACTTCTATTAAAGCTCGAGCTTTAATAGAAGTTAGCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177985.2-344s21c1
Sequence:CCGGGACAGAGAGAGGATTTCTGTACTCGAGTACAGAAATCCTCTCTCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177985.2-290s21c1
Sequence:CCGGTGGAACACTTACTATACTAACCTCGAGGTTAGTATAGTAAGTGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177985.2-571s21c1
Sequence:CCGGATGGATGATGTCACGACTTAACTCGAGTTAAGTCGTGACATCATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177985.2-243s21c1
Sequence:CCGGGTTTCCTAATGTGGGATATTGCTCGAGCAATATCCCACATTAGGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177985.2-810s21c1
Sequence:CCGGTTGAAGCTGTGATTGACATTTCTCGAGAAATGTCAATCACAGCTTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177985.2-266s21c1
Sequence:GTACCGGGGCCAAGAATCTCTTCGTTCTCTCGAGAGAACGAAGAGATTCTTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177985.2-313s21c1
Sequence:GTACCGGAGAGTTTGTAATAGTTGTTGTCTCGAGACAACAACTATTACAAACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177985
VALIDATED
ARL5A MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 5A
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_177985.1-331s1c1
Sequence:CCGGGACAGAGAGAGGATTTCTGTACTCGAGTACAGAAATCCTCTCTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_177985.1-335s1c1
Sequence:CCGGGAGAGAGGATTTCTGTAACTACTCGAGTAGTTACAGAAATCCTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_177985.1-275s1c1
Sequence:CCGGCCTGGAACACTTACTATACTACTCGAGTAGTATAGTAAGTGTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_177985.1-556s1c1
Sequence:CCGGGAATGGATGATGTCACGACTTCTCGAGAAGTCGTGACATCATCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177985.1-443s1c1
Sequence:CCGGGCATGACTGTAGCAGAAATCTCTCGAGAGATTTCTGCTACAGTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177985.1-254s1c1
Sequence:CCGGGCCAAGAATCTCTTCGTTCTTCTCGAGAAGAACGAAGAGATTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177985.1-754s1c1
Sequence:CCGGCCTTCCAGTTTGCTTTCTCATCTCGAGATGAGAAAGCAAACTGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177985.2-486s21c1
Sequence:GTACCGGTGAAGCTAACTTCTATTAAAGCTCGAGCTTTAATAGAAGTTAGCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177985.2-344s21c1
Sequence:CCGGGACAGAGAGAGGATTTCTGTACTCGAGTACAGAAATCCTCTCTCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177985.2-290s21c1
Sequence:CCGGTGGAACACTTACTATACTAACCTCGAGGTTAGTATAGTAAGTGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177985.2-571s21c1
Sequence:CCGGATGGATGATGTCACGACTTAACTCGAGTTAAGTCGTGACATCATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177985.2-243s21c1
Sequence:CCGGGTTTCCTAATGTGGGATATTGCTCGAGCAATATCCCACATTAGGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177985.2-810s21c1
Sequence:CCGGTTGAAGCTGTGATTGACATTTCTCGAGAAATGTCAATCACAGCTTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177985.2-266s21c1
Sequence:GTACCGGGGCCAAGAATCTCTTCGTTCTCTCGAGAGAACGAAGAGATTCTTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177985.2-313s21c1
Sequence:GTACCGGAGAGTTTGTAATAGTTGTTGTCTCGAGACAACAACTATTACAAACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177985
VALIDATED
ARL5A MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 5A
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_177985.1-331s1c1
Sequence:CCGGGACAGAGAGAGGATTTCTGTACTCGAGTACAGAAATCCTCTCTCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_177985.1-335s1c1
Sequence:CCGGGAGAGAGGATTTCTGTAACTACTCGAGTAGTTACAGAAATCCTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_177985.1-275s1c1
Sequence:CCGGCCTGGAACACTTACTATACTACTCGAGTAGTATAGTAAGTGTTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_177985.1-556s1c1
Sequence:CCGGGAATGGATGATGTCACGACTTCTCGAGAAGTCGTGACATCATCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177985.1-443s1c1
Sequence:CCGGGCATGACTGTAGCAGAAATCTCTCGAGAGATTTCTGCTACAGTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177985.1-254s1c1
Sequence:CCGGGCCAAGAATCTCTTCGTTCTTCTCGAGAAGAACGAAGAGATTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177985.1-754s1c1
Sequence:CCGGCCTTCCAGTTTGCTTTCTCATCTCGAGATGAGAAAGCAAACTGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177985.2-486s21c1
Sequence:GTACCGGTGAAGCTAACTTCTATTAAAGCTCGAGCTTTAATAGAAGTTAGCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177985.2-344s21c1
Sequence:CCGGGACAGAGAGAGGATTTCTGTACTCGAGTACAGAAATCCTCTCTCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177985.2-290s21c1
Sequence:CCGGTGGAACACTTACTATACTAACCTCGAGGTTAGTATAGTAAGTGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177985.2-571s21c1
Sequence:CCGGATGGATGATGTCACGACTTAACTCGAGTTAAGTCGTGACATCATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177985.2-243s21c1
Sequence:CCGGGTTTCCTAATGTGGGATATTGCTCGAGCAATATCCCACATTAGGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177985.2-810s21c1
Sequence:CCGGTTGAAGCTGTGATTGACATTTCTCGAGAAATGTCAATCACAGCTTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177985.2-266s21c1
Sequence:GTACCGGGGCCAAGAATCTCTTCGTTCTCTCGAGAGAACGAAGAGATTCTTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177985.2-313s21c1
Sequence:GTACCGGAGAGTTTGTAATAGTTGTTGTCTCGAGACAACAACTATTACAAACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182994
ARL5A MISSION shRNA Bacterial Glycerol Stock
ADP-ribosylation factor-like 5A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182994.1-445s1c1
Sequence:CCGGGCCAAGAATCACTTCGTCCTTCTCGAGAAGGACGAAGTGATTCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182994.1-419s1c1
Sequence:CCGGCCGTTTCCTGATGTGGGATATCTCGAGATATCCCACATCAGGAAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182994.1-362s1c1
Sequence:CCGGCGTACACACATCTCCTACAATCTCGAGATTGTAGGAGATGTGTGTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182994.1-1109s1c1
Sequence:CCGGCCCTTCACATTGAATCAAATACTCGAGTATTTGATTCAATGTGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182994.1-737s1c1
Sequence:CCGGCCAAGGACTTGAATGGATGATCTCGAGATCATCCATTCAAGTCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182994.2-445s21c1
Sequence:CCGGGCCAAGAATCACTTCGTCCTTCTCGAGAAGGACGAAGTGATTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182994.2-362s21c1
Sequence:CCGGCGTACACACATCTCCTACAATCTCGAGATTGTAGGAGATGTGTGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182994.2-737s21c1
Sequence:CCGGCCAAGGACTTGAATGGATGATCTCGAGATCATCCATTCAAGTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182994.2-419s21c1
Sequence:CCGGCCGTTTCCTGATGTGGGATATCTCGAGATATCCCACATCAGGAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182994
ARL5A MISSION shRNA shRNA Plasmid DNA
ADP-ribosylation factor-like 5A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182994.1-445s1c1
Sequence:CCGGGCCAAGAATCACTTCGTCCTTCTCGAGAAGGACGAAGTGATTCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182994.1-419s1c1
Sequence:CCGGCCGTTTCCTGATGTGGGATATCTCGAGATATCCCACATCAGGAAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182994.1-362s1c1
Sequence:CCGGCGTACACACATCTCCTACAATCTCGAGATTGTAGGAGATGTGTGTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182994.1-1109s1c1
Sequence:CCGGCCCTTCACATTGAATCAAATACTCGAGTATTTGATTCAATGTGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182994.1-737s1c1
Sequence:CCGGCCAAGGACTTGAATGGATGATCTCGAGATCATCCATTCAAGTCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182994.2-445s21c1
Sequence:CCGGGCCAAGAATCACTTCGTCCTTCTCGAGAAGGACGAAGTGATTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182994.2-362s21c1
Sequence:CCGGCGTACACACATCTCCTACAATCTCGAGATTGTAGGAGATGTGTGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182994.2-737s21c1
Sequence:CCGGCCAAGGACTTGAATGGATGATCTCGAGATCATCCATTCAAGTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182994.2-419s21c1
Sequence:CCGGCCGTTTCCTGATGTGGGATATCTCGAGATATCCCACATCAGGAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182994
ARL5A MISSION shRNA Lentiviral Transduction Particles
ADP-ribosylation factor-like 5A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182994.1-445s1c1
Sequence:CCGGGCCAAGAATCACTTCGTCCTTCTCGAGAAGGACGAAGTGATTCTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182994.1-419s1c1
Sequence:CCGGCCGTTTCCTGATGTGGGATATCTCGAGATATCCCACATCAGGAAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182994.1-362s1c1
Sequence:CCGGCGTACACACATCTCCTACAATCTCGAGATTGTAGGAGATGTGTGTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182994.1-1109s1c1
Sequence:CCGGCCCTTCACATTGAATCAAATACTCGAGTATTTGATTCAATGTGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182994.1-737s1c1
Sequence:CCGGCCAAGGACTTGAATGGATGATCTCGAGATCATCCATTCAAGTCCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182994.2-445s21c1
Sequence:CCGGGCCAAGAATCACTTCGTCCTTCTCGAGAAGGACGAAGTGATTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182994.2-362s21c1
Sequence:CCGGCGTACACACATCTCCTACAATCTCGAGATTGTAGGAGATGTGTGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182994.2-737s21c1
Sequence:CCGGCCAAGGACTTGAATGGATGATCTCGAGATCATCCATTCAAGTCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182994.2-419s21c1
Sequence:CCGGCCGTTTCCTGATGTGGGATATCTCGAGATATCCCACATCAGGAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)