EMAIL THIS PAGE TO A FRIEND

ARMCX1

armadillo repeat containing, X-linked 1

84 Gene Product Result for
Synonyms: ALEX1
UniProtKB ID: Q9P291, Q53HK2, Q9H2Q0
Gene ID:
Human(51309) Summary: This gene encodes a member of the ALEX family of proteins and may play a role in tumor suppression. The encoded protein contains a potential N-terminal transmembrane domain and two Armadillo (arm) repeats. Other proteins containing the arm repeat are involved in development, maintenance of tissue integrity, and tumorigenesis. This gene is closely localized with other family members, including ALEX2 and ALEX3, on the X chromosome. [provided by RefSeq, Jul 2008]
Mouse(78248) armadillo repeat containing, X-linked 1
Rat(501619) armadillo repeat containing, X-linked 1
naked mole-rat(101711429) armadillo repeat containing, X-linked 1
domestic guinea pig(100728890) armadillo repeat containing, X-linked 1
sheep(101106745) armadillo repeat containing, X-linked 1
Domestic Rabbit(100351951) armadillo repeat containing, X-linked 1
cow(504577) armadillo repeat containing, X-linked 1
domestic cat(101088819) armadillo repeat containing, X-linked 1
dog(480990) armadillo repeat containing, X-linked 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016608 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016608 Rosetta Predictions human pricing
NM_001024367 Rosetta Predictions rat pricing
NM_030066 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092969 predicted 1060
2 SASI_Hs01_00092972 predicted 1210
3 SASI_Hs02_00349751 predicted 1585
4 SASI_Hs02_00349752 predicted 565
5 SASI_Hs01_00092977 predicted 707
6 SASI_Hs02_00349753 predicted 1680
7 SASI_Hs02_00349754 predicted 1079
8 SASI_Hs02_00349755 predicted 1481
9 SASI_Hs02_00349756 predicted 1220
10 SASI_Hs02_00349757 predicted 1053
11 SASI_Hs01_00092968 predicted 1520
12 SASI_Hs01_00092970 predicted 1324
13 SASI_Hs01_00092971 predicted 1291
14 SASI_Hs01_00092973 predicted 1783
15 SASI_Hs01_00092974 predicted 1388
16 SASI_Hs01_00092975 predicted 1312
17 SASI_Hs01_00092976 predicted 1526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024367 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073757 predicted 574
2 SASI_Rn01_00073758 predicted 1329
3 SASI_Rn01_00073759 predicted 1401
4 SASI_Rn01_00073760 predicted 626
5 SASI_Rn01_00073761 predicted 1698
6 SASI_Rn01_00073762 predicted 1510
7 SASI_Rn01_00073763 predicted 1218
8 SASI_Rn01_00073764 predicted 1290
9 SASI_Rn01_00073765 predicted 746
10 SASI_Rn01_00073766 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179056 predicted 1930
2 SASI_Mm01_00179057 predicted 1379
3 SASI_Mm01_00179058 predicted 1580
4 SASI_Mm01_00179059 predicted 1381
5 SASI_Mm01_00179060 predicted 914
6 SASI_Mm01_00179061 predicted 927
7 SASI_Mm01_00179062 predicted 1685
8 SASI_Mm01_00179063 predicted 1483
9 SASI_Mm02_00336444 predicted 947
10 SASI_Mm01_00179064 predicted 1634
11 SASI_Mm01_00179055 predicted 1113
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030066
ARMCX1 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing, X-linked 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030066.2-2091s1c1
Sequence:CCGGCCACTTTAAGTATGCCAAATACTCGAGTATTTGGCATACTTAAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030066.2-1494s1c1
Sequence:CCGGGTAACTAATCACTACCAACATCTCGAGATGTTGGTAGTGATTAGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030066.2-1353s1c1
Sequence:CCGGGCTCTTAATAACTTGAGCGTTCTCGAGAACGCTCAAGTTATTAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030066.2-1642s1c1
Sequence:CCGGGTTGTAAAGTACCTTCGGAATCTCGAGATTCCGAAGGTACTTTACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030066.2-1838s1c1
Sequence:CCGGCAAAGCATTAGCAAGCCATAACTCGAGTTATGGCTTGCTAATGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030066.2-1528s1c1
Sequence:CCGGCTTTCCCAGATTTCTTTGCTTCTCGAGAAGCAAAGAAATCTGGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030066.2-1235s1c1
Sequence:CCGGGGGTAACAATGCAGCATATTCCTCGAGGAATATGCTGCATTGTTACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030066
ARMCX1 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing, X-linked 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030066.2-2091s1c1
Sequence:CCGGCCACTTTAAGTATGCCAAATACTCGAGTATTTGGCATACTTAAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030066.2-1494s1c1
Sequence:CCGGGTAACTAATCACTACCAACATCTCGAGATGTTGGTAGTGATTAGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030066.2-1353s1c1
Sequence:CCGGGCTCTTAATAACTTGAGCGTTCTCGAGAACGCTCAAGTTATTAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030066.2-1642s1c1
Sequence:CCGGGTTGTAAAGTACCTTCGGAATCTCGAGATTCCGAAGGTACTTTACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030066.2-1838s1c1
Sequence:CCGGCAAAGCATTAGCAAGCCATAACTCGAGTTATGGCTTGCTAATGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030066.2-1528s1c1
Sequence:CCGGCTTTCCCAGATTTCTTTGCTTCTCGAGAAGCAAAGAAATCTGGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030066.2-1235s1c1
Sequence:CCGGGGGTAACAATGCAGCATATTCCTCGAGGAATATGCTGCATTGTTACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030066
ARMCX1 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing, X-linked 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030066.2-2091s1c1
Sequence:CCGGCCACTTTAAGTATGCCAAATACTCGAGTATTTGGCATACTTAAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030066.2-1494s1c1
Sequence:CCGGGTAACTAATCACTACCAACATCTCGAGATGTTGGTAGTGATTAGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030066.2-1353s1c1
Sequence:CCGGGCTCTTAATAACTTGAGCGTTCTCGAGAACGCTCAAGTTATTAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030066.2-1642s1c1
Sequence:CCGGGTTGTAAAGTACCTTCGGAATCTCGAGATTCCGAAGGTACTTTACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030066.2-1838s1c1
Sequence:CCGGCAAAGCATTAGCAAGCCATAACTCGAGTTATGGCTTGCTAATGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030066.2-1528s1c1
Sequence:CCGGCTTTCCCAGATTTCTTTGCTTCTCGAGAAGCAAAGAAATCTGGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030066.2-1235s1c1
Sequence:CCGGGGGTAACAATGCAGCATATTCCTCGAGGAATATGCTGCATTGTTACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016608
ARMCX1 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing, X-linked 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016608.1-933s1c1
Sequence:CCGGCGGAGAGGCAAGTTCAACTTTCTCGAGAAAGTTGAACTTGCCTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016608.1-1768s1c1
Sequence:CCGGGCAGTTGGTACGATGTGATTTCTCGAGAAATCACATCGTACCAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016608.1-1392s1c1
Sequence:CCGGCACTTCACCAAGATACAGATTCTCGAGAATCTGTATCTTGGTGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016608.1-1707s1c1
Sequence:CCGGGTCCTGAAAGTATTAACCAAACTCGAGTTTGGTTAATACTTTCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159226    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016608.1-1813s1c1
Sequence:CCGGCGTATATGGTAAAGAGATCTTCTCGAGAAGATCTCTTTACCATATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016608.1-528s1c1
Sequence:CCGGGAGACTGTGAAAGGAGCTAAACTCGAGTTTAGCTCCTTTCACAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016608.1-1483s1c1
Sequence:CCGGCAGAATTGATTTCCCTCTTTACTCGAGTAAAGAGGGAAATCAATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016608.1-1527s1c1
Sequence:CCGGCTTCTTAATATCCTTACCCTACTCGAGTAGGGTAAGGATATTAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016608.1-1049s1c1
Sequence:CCGGCTTGGTCACTCTGGGTAACAACTCGAGTTGTTACCCAGAGTGACCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016608.1-1584s1c1
Sequence:CCGGCTCGCATCATCCAGGAAAGAACTCGAGTTCTTTCCTGGATGATGCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016608.1-1295s1c1
Sequence:CCGGGCTAAGACTGTTAACCAACATCTCGAGATGTTGGTTAACAGTCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016608
ARMCX1 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing, X-linked 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016608.1-933s1c1
Sequence:CCGGCGGAGAGGCAAGTTCAACTTTCTCGAGAAAGTTGAACTTGCCTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016608.1-1768s1c1
Sequence:CCGGGCAGTTGGTACGATGTGATTTCTCGAGAAATCACATCGTACCAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016608.1-1392s1c1
Sequence:CCGGCACTTCACCAAGATACAGATTCTCGAGAATCTGTATCTTGGTGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016608.1-1707s1c1
Sequence:CCGGGTCCTGAAAGTATTAACCAAACTCGAGTTTGGTTAATACTTTCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159226    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016608.1-1813s1c1
Sequence:CCGGCGTATATGGTAAAGAGATCTTCTCGAGAAGATCTCTTTACCATATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016608.1-528s1c1
Sequence:CCGGGAGACTGTGAAAGGAGCTAAACTCGAGTTTAGCTCCTTTCACAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016608.1-1483s1c1
Sequence:CCGGCAGAATTGATTTCCCTCTTTACTCGAGTAAAGAGGGAAATCAATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016608.1-1527s1c1
Sequence:CCGGCTTCTTAATATCCTTACCCTACTCGAGTAGGGTAAGGATATTAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016608.1-1049s1c1
Sequence:CCGGCTTGGTCACTCTGGGTAACAACTCGAGTTGTTACCCAGAGTGACCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016608.1-1584s1c1
Sequence:CCGGCTCGCATCATCCAGGAAAGAACTCGAGTTCTTTCCTGGATGATGCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016608.1-1295s1c1
Sequence:CCGGGCTAAGACTGTTAACCAACATCTCGAGATGTTGGTTAACAGTCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016608
ARMCX1 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing, X-linked 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016608.1-933s1c1
Sequence:CCGGCGGAGAGGCAAGTTCAACTTTCTCGAGAAAGTTGAACTTGCCTCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016608.1-1768s1c1
Sequence:CCGGGCAGTTGGTACGATGTGATTTCTCGAGAAATCACATCGTACCAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016608.1-1392s1c1
Sequence:CCGGCACTTCACCAAGATACAGATTCTCGAGAATCTGTATCTTGGTGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016608.1-1707s1c1
Sequence:CCGGGTCCTGAAAGTATTAACCAAACTCGAGTTTGGTTAATACTTTCAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159226    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016608.1-1813s1c1
Sequence:CCGGCGTATATGGTAAAGAGATCTTCTCGAGAAGATCTCTTTACCATATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016608.1-528s1c1
Sequence:CCGGGAGACTGTGAAAGGAGCTAAACTCGAGTTTAGCTCCTTTCACAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016608.1-1483s1c1
Sequence:CCGGCAGAATTGATTTCCCTCTTTACTCGAGTAAAGAGGGAAATCAATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016608.1-1527s1c1
Sequence:CCGGCTTCTTAATATCCTTACCCTACTCGAGTAGGGTAAGGATATTAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016608.1-1049s1c1
Sequence:CCGGCTTGGTCACTCTGGGTAACAACTCGAGTTGTTACCCAGAGTGACCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016608.1-1584s1c1
Sequence:CCGGCTCGCATCATCCAGGAAAGAACTCGAGTTCTTTCCTGGATGATGCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016608.1-1295s1c1
Sequence:CCGGGCTAAGACTGTTAACCAACATCTCGAGATGTTGGTTAACAGTCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)