EMAIL THIS PAGE TO A FRIEND

ARMCX3

armadillo repeat containing, X-linked 3

198 Gene Product Result for
Synonyms: ALEX3 dJ545K15.2
UniProtKB ID: Q9UH62, Q53HC6, Q7LCF5, Q9NPE4
Gene ID:
Human(51566) Summary: This gene encodes a member of the ALEX family of proteins which may play a role in tumor suppression. The encoded protein contains a potential N-terminal transmembrane domain and a single Armadillo (arm) repeat. Other proteins containing the arm repeat are involved in development, maintenance of tissue integrity, and tumorigenesis. This gene is closely localized with other family members on the X chromosome. Three transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(71703) armadillo repeat containing, X-linked 3
Rat(367902) armadillo repeat containing, X-linked 3
naked mole-rat(101710702) armadillo repeat containing, X-linked 3
domestic guinea pig(100725848) armadillo repeat containing, X-linked 3
sheep(101107578) armadillo repeat containing, X-linked 3
dog(492022) armadillo repeat containing, X-linked 3
domestic cat(101089083) armadillo repeat containing, X-linked 3
cow(516747) armadillo repeat containing, X-linked 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016607 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027870 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027870 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027870 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016607 Rosetta Predictions human pricing
NM_177947 Rosetta Predictions human pricing
NM_177948 Rosetta Predictions human pricing
NM_001014273 Rosetta Predictions rat pricing
NM_027870 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349744 predicted 1810
2 SASI_Hs01_00023372 predicted 1128
3 SASI_Hs02_00349745 predicted 1218
4 SASI_Hs02_00349746 predicted 1213
5 SASI_Hs01_00023375 predicted 1040
6 SASI_Hs02_00349747 predicted 1788
7 SASI_Hs02_00349748 predicted 1195
8 SASI_Hs01_00023376 predicted 1148
9 SASI_Hs02_00349749 predicted 1187
10 SASI_Hs02_00349750 predicted 1308
11 SASI_Hs01_00023370 predicted 1124
12 SASI_Hs01_00023371 predicted 1055
13 SASI_Hs01_00023373 predicted 1128
14 SASI_Hs01_00023374 predicted 1122
15 SASI_Hs01_00023377 predicted 1126
16 SASI_Hs01_00023378 predicted 1059
17 SASI_Hs01_00023379 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369422 predicted 1020
2 SASI_Hs02_00369423 predicted 1020
3 SASI_Hs01_00120523 predicted 1099
4 SASI_Hs02_00369424 predicted 1090
5 SASI_Hs02_00369425 predicted 1088
6 SASI_Hs01_00120526 predicted 1017
7 SASI_Hs01_00120529 predicted 1121
8 SASI_Hs02_00369426 predicted 1090
9 SASI_Hs02_00369427 predicted 1024
10 SASI_Hs02_00369428 predicted 1005
11 SASI_Hs01_00120522 predicted 1177
12 SASI_Hs01_00120524 predicted 1202
13 SASI_Hs01_00120525 predicted 1189
14 SASI_Hs01_00120527 predicted 1764
15 SASI_Hs01_00120528 predicted 1176
16 SASI_Hs01_00120530 predicted 1161
17 SASI_Hs01_00120531 predicted 1283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369429 predicted 979
2 SASI_Hs01_00180196 predicted 973
3 SASI_Hs01_00180197 predicted 1049
4 SASI_Hs01_00180198 predicted 1042
5 SASI_Hs01_00180199 predicted 1047
6 SASI_Hs01_00180200 predicted 970
7 SASI_Hs01_00180201 predicted 1065
8 SASI_Hs01_00180202 predicted 1036
9 SASI_Hs01_00180203 predicted 974
10 SASI_Hs01_00180204 predicted 954
11 SASI_Hs01_00180195 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112373 predicted 931
2 SASI_Rn02_00201846 predicted 495
3 SASI_Rn01_00112374 predicted 1027
4 SASI_Rn01_00112375 predicted 1130
5 SASI_Rn02_00201847 predicted 495
6 SASI_Rn01_00112376 predicted 770
7 SASI_Rn01_00112377 predicted 1213
8 SASI_Rn01_00112378 predicted 1128
9 SASI_Rn01_00112379 predicted 600
10 SASI_Rn01_00112380 predicted 1118
11 SASI_Rn01_00112381 predicted 819
12 SASI_Rn01_00112382 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332829 predicted 551
2 SASI_Mm01_00109183 predicted 1462
3 SASI_Mm01_00109184 predicted 1176
4 SASI_Mm01_00109185 predicted 1161
5 SASI_Mm02_00332830 predicted 550
6 SASI_Mm01_00109186 predicted 820
7 SASI_Mm01_00109187 predicted 890
8 SASI_Mm01_00109188 predicted 1174
9 SASI_Mm01_00109190 predicted 652
10 SASI_Mm01_00109191 predicted 649
11 SASI_Mm01_00109189 predicted 1570
12 SASI_Mm01_00109192 predicted 957
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016607
VALIDATED
ARMCX3 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing, X-linked 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.2-954s1c1
Sequence:CCGGGCAGCTTTAATTGCTCTGGGTCTCGAGACCCAGAGCAATTAAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.2-731s1c1
Sequence:CCGGCAGCAATGAGAGCAAGAGTATCTCGAGATACTCTTGCTCTCATTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.2-1302s1c1
Sequence:CCGGGAAGAAACCAAACTTCAGGTTCTCGAGAACCTGAAGTTTGGTTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.2-589s1c1
Sequence:CCGGGCGCCTGCTATTGCATTTATACTCGAGTATAAATGCAATAGCAGGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.3-1727s1c1
Sequence:CCGGCCACCTTGTTTATATGGTAAACTCGAGTTTACCATATAAACAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.3-1449s1c1
Sequence:CCGGCTGGTCATATTTGAGAACATACTCGAGTATGTTCTCAAATATGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.3-915s1c1
Sequence:CCGGTGCTTGGTTGAGATGTCTGAACTCGAGTTCAGACATCTCAACCAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.3-865s1c1
Sequence:CCGGCCAATTCAGATGATACCGTTTCTCGAGAAACGGTATCATCTGAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016607.3-1449s21c1
Sequence:CCGGCTGGTCATATTTGAGAACATACTCGAGTATGTTCTCAAATATGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016607.3-915s21c1
Sequence:CCGGTGCTTGGTTGAGATGTCTGAACTCGAGTTCAGACATCTCAACCAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016607.3-1727s21c1
Sequence:CCGGCCACCTTGTTTATATGGTAAACTCGAGTTTACCATATAAACAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016607.3-731s21c1
Sequence:CCGGCAGCAATGAGAGCAAGAGTATCTCGAGATACTCTTGCTCTCATTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016607.3-1302s21c1
Sequence:CCGGGAAGAAACCAAACTTCAGGTTCTCGAGAACCTGAAGTTTGGTTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016607
VALIDATED
ARMCX3 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing, X-linked 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.2-954s1c1
Sequence:CCGGGCAGCTTTAATTGCTCTGGGTCTCGAGACCCAGAGCAATTAAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.2-731s1c1
Sequence:CCGGCAGCAATGAGAGCAAGAGTATCTCGAGATACTCTTGCTCTCATTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.2-1302s1c1
Sequence:CCGGGAAGAAACCAAACTTCAGGTTCTCGAGAACCTGAAGTTTGGTTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.2-589s1c1
Sequence:CCGGGCGCCTGCTATTGCATTTATACTCGAGTATAAATGCAATAGCAGGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.3-1727s1c1
Sequence:CCGGCCACCTTGTTTATATGGTAAACTCGAGTTTACCATATAAACAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.3-1449s1c1
Sequence:CCGGCTGGTCATATTTGAGAACATACTCGAGTATGTTCTCAAATATGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.3-915s1c1
Sequence:CCGGTGCTTGGTTGAGATGTCTGAACTCGAGTTCAGACATCTCAACCAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.3-865s1c1
Sequence:CCGGCCAATTCAGATGATACCGTTTCTCGAGAAACGGTATCATCTGAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016607.3-1449s21c1
Sequence:CCGGCTGGTCATATTTGAGAACATACTCGAGTATGTTCTCAAATATGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016607.3-915s21c1
Sequence:CCGGTGCTTGGTTGAGATGTCTGAACTCGAGTTCAGACATCTCAACCAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016607.3-1727s21c1
Sequence:CCGGCCACCTTGTTTATATGGTAAACTCGAGTTTACCATATAAACAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016607.3-731s21c1
Sequence:CCGGCAGCAATGAGAGCAAGAGTATCTCGAGATACTCTTGCTCTCATTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016607.3-1302s21c1
Sequence:CCGGGAAGAAACCAAACTTCAGGTTCTCGAGAACCTGAAGTTTGGTTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016607
VALIDATED
ARMCX3 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing, X-linked 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.2-954s1c1
Sequence:CCGGGCAGCTTTAATTGCTCTGGGTCTCGAGACCCAGAGCAATTAAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.2-731s1c1
Sequence:CCGGCAGCAATGAGAGCAAGAGTATCTCGAGATACTCTTGCTCTCATTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.2-1302s1c1
Sequence:CCGGGAAGAAACCAAACTTCAGGTTCTCGAGAACCTGAAGTTTGGTTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.2-589s1c1
Sequence:CCGGGCGCCTGCTATTGCATTTATACTCGAGTATAAATGCAATAGCAGGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.3-1727s1c1
Sequence:CCGGCCACCTTGTTTATATGGTAAACTCGAGTTTACCATATAAACAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.3-1449s1c1
Sequence:CCGGCTGGTCATATTTGAGAACATACTCGAGTATGTTCTCAAATATGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.3-915s1c1
Sequence:CCGGTGCTTGGTTGAGATGTCTGAACTCGAGTTCAGACATCTCAACCAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016607.3-865s1c1
Sequence:CCGGCCAATTCAGATGATACCGTTTCTCGAGAAACGGTATCATCTGAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016607.3-1449s21c1
Sequence:CCGGCTGGTCATATTTGAGAACATACTCGAGTATGTTCTCAAATATGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016607.3-915s21c1
Sequence:CCGGTGCTTGGTTGAGATGTCTGAACTCGAGTTCAGACATCTCAACCAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016607.3-1727s21c1
Sequence:CCGGCCACCTTGTTTATATGGTAAACTCGAGTTTACCATATAAACAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016607.3-731s21c1
Sequence:CCGGCAGCAATGAGAGCAAGAGTATCTCGAGATACTCTTGCTCTCATTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016607.3-1302s21c1
Sequence:CCGGGAAGAAACCAAACTTCAGGTTCTCGAGAACCTGAAGTTTGGTTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027870
ARMCX3 MISSION shRNA Bacterial Glycerol Stock
armadillo repeat containing, X-linked 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027870.1-1365s1c1
Sequence:CCGGCCTCTTTAATAAGAAGGAGTACTCGAGTACTCCTTCTTATTAAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027870.1-1689s1c1
Sequence:CCGGCCACGTTGTTTATATGGCAAACTCGAGTTTGCCATATAAACAACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027870.1-1567s1c1
Sequence:CCGGCGAGTCAAGGTTGGAAAGTTTCTCGAGAAACTTTCCAACCTTGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027870.1-1050s1c1
Sequence:CCGGCCTAAATAACTTGAGCGTGAACTCGAGTTCACGCTCAAGTTATTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027870.1-576s1c1
Sequence:CCGGCCGAGGAAGAAAGCAGAACAACTCGAGTTGTTCTGCTTTCTTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027870.1-1689s21c1
Sequence:CCGGCCACGTTGTTTATATGGCAAACTCGAGTTTGCCATATAAACAACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027870.1-1379s21c1
Sequence:CCGGAGGAGTACAAAGAGGTTATTCCTCGAGGAATAACCTCTTTGTACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027870.1-919s21c1
Sequence:CCGGTTAATTGCTCTGGGTAATAATCTCGAGATTATTACCCAGAGCAATTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027870.1-1081s21c1
Sequence:CCGGCAGCGCAGGCTTAAGGTATACCTCGAGGTATACCTTAAGCCTGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027870.1-1228s21c1
Sequence:CCGGTCAGACTTCTTTCGTTTATTTCTCGAGAAATAAACGAAAGAAGTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027870
ARMCX3 MISSION shRNA shRNA Plasmid DNA
armadillo repeat containing, X-linked 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027870.1-1365s1c1
Sequence:CCGGCCTCTTTAATAAGAAGGAGTACTCGAGTACTCCTTCTTATTAAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027870.1-1689s1c1
Sequence:CCGGCCACGTTGTTTATATGGCAAACTCGAGTTTGCCATATAAACAACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027870.1-1567s1c1
Sequence:CCGGCGAGTCAAGGTTGGAAAGTTTCTCGAGAAACTTTCCAACCTTGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027870.1-1050s1c1
Sequence:CCGGCCTAAATAACTTGAGCGTGAACTCGAGTTCACGCTCAAGTTATTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027870.1-576s1c1
Sequence:CCGGCCGAGGAAGAAAGCAGAACAACTCGAGTTGTTCTGCTTTCTTCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027870.1-1689s21c1
Sequence:CCGGCCACGTTGTTTATATGGCAAACTCGAGTTTGCCATATAAACAACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027870.1-1379s21c1
Sequence:CCGGAGGAGTACAAAGAGGTTATTCCTCGAGGAATAACCTCTTTGTACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027870.1-919s21c1
Sequence:CCGGTTAATTGCTCTGGGTAATAATCTCGAGATTATTACCCAGAGCAATTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027870.1-1081s21c1
Sequence:CCGGCAGCGCAGGCTTAAGGTATACCTCGAGGTATACCTTAAGCCTGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027870.1-1228s21c1
Sequence:CCGGTCAGACTTCTTTCGTTTATTTCTCGAGAAATAAACGAAAGAAGTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027870
ARMCX3 MISSION shRNA Lentiviral Transduction Particles
armadillo repeat containing, X-linked 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027870.1-1365s1c1
Sequence:CCGGCCTCTTTAATAAGAAGGAGTACTCGAGTACTCCTTCTTATTAAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027870.1-1689s1c1
Sequence:CCGGCCACGTTGTTTATATGGCAAACTCGAGTTTGCCATATAAACAACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027870.1-1567s1c1
Sequence:CCGGCGAGTCAAGGTTGGAAAGTTTCTCGAGAAACTTTCCAACCTTGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027870.1-1050s1c1
Sequence:CCGGCCTAAATAACTTGAGCGTGAACTCGAGTTCACGCTCAAGTTATTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027870.1-576s1c1
Sequence:CCGGCCGAGGAAGAAAGCAGAACAACTCGAGTTGTTCTGCTTTCTTCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027870.1-1689s21c1
Sequence:CCGGCCACGTTGTTTATATGGCAAACTCGAGTTTGCCATATAAACAACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027870.1-1379s21c1
Sequence:CCGGAGGAGTACAAAGAGGTTATTCCTCGAGGAATAACCTCTTTGTACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027870.1-919s21c1
Sequence:CCGGTTAATTGCTCTGGGTAATAATCTCGAGATTATTACCCAGAGCAATTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027870.1-1081s21c1
Sequence:CCGGCAGCGCAGGCTTAAGGTATACCTCGAGGTATACCTTAAGCCTGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027870.1-1228s21c1
Sequence:CCGGTCAGACTTCTTTCGTTTATTTCTCGAGAAATAAACGAAAGAAGTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)