EMAIL THIS PAGE TO A FRIEND

ARSA

arylsulfatase A

96 Gene Product Result for
Synonyms: MLD
UniProtKB ID: P15289, B2RCA6, B7XD04, F8WCC8, Q6ICI5, Q96CJ0
Gene ID:
Human(410) Summary: The protein encoded by this gene hydrolyzes cerebroside sulfate to cerebroside and sulfate. Defects in this gene lead to metachromatic leucodystrophy (MLD), a progressive demyelination disease which results in a variety of neurological symptoms and ultimately death. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2010]
Mouse(11883) arylsulfatase A
Rat(315222) arylsulfatase A
Zebrafish(541416) arylsulfatase A
chicken(426863) arylsulfatase A
dog(474457) arylsulfatase A
domestic cat(101083690) arylsulfatase A
cow(505514) arylsulfatase A
sheep(101122266) arylsulfatase A
Domestic Rabbit(100351118) arylsulfatase A
naked mole-rat(101722754) arylsulfatase A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009713 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009713 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009713 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000487 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000487 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000487 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000487 Rosetta Predictions human pricing
NM_001085425 Rosetta Predictions human pricing
NM_001085426 Rosetta Predictions human pricing
NM_001085427 Rosetta Predictions human pricing
NM_001085428 Rosetta Predictions human pricing
NM_001034933 Rosetta Predictions rat pricing
NM_009713 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142892 predicted 1116
2 SASI_Hs01_00142893 predicted 1092
3 SASI_Hs01_00142894 predicted 1108
4 SASI_Hs01_00142895 predicted 1088
5 SASI_Hs01_00142896 predicted 872
6 SASI_Hs01_00142897 predicted 995
7 SASI_Hs01_00142898 predicted 1797
8 SASI_Hs01_00142899 predicted 1315
9 SASI_Hs02_00302639 predicted 829
10 SASI_Hs02_00302640 predicted 883
11 SASI_Hs01_00142890 predicted 718
12 SASI_Hs01_00142891 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317655 predicted 1016
2 SASI_Hs02_00317656 predicted 994
3 SASI_Hs02_00317657 predicted 998
4 SASI_Hs02_00317658 predicted 978
5 SASI_Hs02_00317659 predicted 758
6 SASI_Hs02_00317660 predicted 897
7 SASI_Hs02_00317661 predicted 1687
8 SASI_Hs02_00317662 predicted 1213
9 SASI_Hs02_00317663 predicted 722
10 SASI_Hs02_00317664 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317665 predicted 969
2 SASI_Hs02_00317666 predicted 941
3 SASI_Hs02_00317667 predicted 950
4 SASI_Hs02_00317668 predicted 936
5 SASI_Hs02_00317669 predicted 714
6 SASI_Hs02_00317670 predicted 851
7 SASI_Hs02_00317671 predicted 1642
8 SASI_Hs02_00317672 predicted 1166
9 SASI_Hs02_00317673 predicted 677
10 SASI_Hs02_00317674 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317675 predicted 926
2 SASI_Hs02_00317676 predicted 894
3 SASI_Hs02_00317677 predicted 904
4 SASI_Hs02_00317678 predicted 887
5 SASI_Hs02_00317679 predicted 667
6 SASI_Hs02_00317680 predicted 800
7 SASI_Hs02_00317681 predicted 1595
8 SASI_Hs02_00317682 predicted 1117
9 SASI_Hs02_00317683 predicted 627
10 SASI_Hs02_00317684 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317685 predicted 729
2 SASI_Hs02_00317686 predicted 709
3 SASI_Hs02_00317687 predicted 718
4 SASI_Hs02_00317688 predicted 699
5 SASI_Hs02_00317689 predicted 479
6 SASI_Hs02_00317690 predicted 608
7 SASI_Hs02_00317691 predicted 1405
8 SASI_Hs02_00317692 predicted 927
9 SASI_Hs02_00317693 predicted 440
10 SASI_Hs02_00317694 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034933 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034293 predicted 1297
2 SASI_Rn01_00034294 predicted 680
3 SASI_Rn01_00034297 predicted 425
4 SASI_Rn01_00034298 predicted 1091
5 SASI_Rn02_00204114 predicted 1084
6 SASI_Rn02_00204115 predicted 828
7 SASI_Rn01_00034300 predicted 1271
8 SASI_Rn02_00204116 predicted 834
9 SASI_Rn02_00204117 predicted 465
10 SASI_Rn01_00034296 predicted 1144
11 SASI_Rn01_00034292 predicted 1702
12 SASI_Rn01_00034295 predicted 744
13 SASI_Rn01_00034299 predicted 1777
14 SASI_Rn01_00034301 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316861 predicted 1642
2 SASI_Mm01_00090549 predicted 2877
3 SASI_Mm01_00090550 predicted 2859
4 SASI_Mm01_00090552 predicted 2838
5 SASI_Mm01_00090553 predicted 1273
6 SASI_Mm01_00090554 predicted 2168
7 SASI_Mm01_00090555 predicted 2497
8 SASI_Mm01_00090556 predicted 2870
9 SASI_Mm01_00090557 predicted 2577
10 SASI_Mm01_00090558 predicted 2454
11 SASI_Mm01_00090551 predicted 1277
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009713
VALIDATED
ARSA MISSION shRNA Bacterial Glycerol Stock
arylsulfatase A
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009713.3-2839s21c1
Sequence:CCGGGTGTAGTTTGTATCTGGTAATCTCGAGATTACCAGATACAAACTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009713.3-2378s21c1
Sequence:CCGGTGCTGTTCGGAATGGGAAATACTCGAGTATTTCCCATTCCGAACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009713.3-1382s21c1
Sequence:CCGGTGGACTACGGTTCACAGATTTCTCGAGAAATCTGTGAACCGTAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009713.3-1646s21c1
Sequence:CCGGATTCCTGGGCATCCCATATTCCTCGAGGAATATGGGATGCCCAGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009713.3-2042s21c1
Sequence:CCGGAGTCATCTTCACTGCAGATAACTCGAGTTATCTGCAGTGAAGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009713.3-2492s21c1
Sequence:CCGGCCCACTGCTCTACGACTTATCCTCGAGGATAAGTCGTAGAGCAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009713.3-2165s21c1
Sequence:CCGGCTACTGGCCAGGTCACATTACCTCGAGGTAATGTGACCTGGCCAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009713.2-2999s1c1
Sequence:CCGGCCACCTTACCAGAAAGAGCTTCTCGAGAAGCTCTTTCTGGTAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009713.2-2321s1c1
Sequence:CCGGCCCACGGAAGTCTGTCTTCTTCTCGAGAAGAAGACAGACTTCCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009713.2-1865s1c1
Sequence:CCGGCCGACCGTTCTTCCTGTACTACTCGAGTAGTACAGGAAGAACGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009713.2-2027s1c1
Sequence:CCGGGCTGGAAGAGACACTAGTCATCTCGAGATGACTAGTGTCTCTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009713.2-1278s1c1
Sequence:CCGGCCTAACATCCTGCTGATCTTTCTCGAGAAAGATCAGCAGGATGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009713
VALIDATED
ARSA MISSION shRNA shRNA Plasmid DNA
arylsulfatase A
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009713.3-2839s21c1
Sequence:CCGGGTGTAGTTTGTATCTGGTAATCTCGAGATTACCAGATACAAACTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009713.3-2378s21c1
Sequence:CCGGTGCTGTTCGGAATGGGAAATACTCGAGTATTTCCCATTCCGAACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009713.3-1382s21c1
Sequence:CCGGTGGACTACGGTTCACAGATTTCTCGAGAAATCTGTGAACCGTAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009713.3-1646s21c1
Sequence:CCGGATTCCTGGGCATCCCATATTCCTCGAGGAATATGGGATGCCCAGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009713.3-2042s21c1
Sequence:CCGGAGTCATCTTCACTGCAGATAACTCGAGTTATCTGCAGTGAAGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009713.3-2492s21c1
Sequence:CCGGCCCACTGCTCTACGACTTATCCTCGAGGATAAGTCGTAGAGCAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009713.3-2165s21c1
Sequence:CCGGCTACTGGCCAGGTCACATTACCTCGAGGTAATGTGACCTGGCCAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009713.2-2999s1c1
Sequence:CCGGCCACCTTACCAGAAAGAGCTTCTCGAGAAGCTCTTTCTGGTAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009713.2-2321s1c1
Sequence:CCGGCCCACGGAAGTCTGTCTTCTTCTCGAGAAGAAGACAGACTTCCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009713.2-1865s1c1
Sequence:CCGGCCGACCGTTCTTCCTGTACTACTCGAGTAGTACAGGAAGAACGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009713.2-2027s1c1
Sequence:CCGGGCTGGAAGAGACACTAGTCATCTCGAGATGACTAGTGTCTCTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009713.2-1278s1c1
Sequence:CCGGCCTAACATCCTGCTGATCTTTCTCGAGAAAGATCAGCAGGATGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009713
VALIDATED
ARSA MISSION shRNA Lentiviral Transduction Particles
arylsulfatase A
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009713.3-2839s21c1
Sequence:CCGGGTGTAGTTTGTATCTGGTAATCTCGAGATTACCAGATACAAACTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009713.3-2378s21c1
Sequence:CCGGTGCTGTTCGGAATGGGAAATACTCGAGTATTTCCCATTCCGAACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009713.3-1382s21c1
Sequence:CCGGTGGACTACGGTTCACAGATTTCTCGAGAAATCTGTGAACCGTAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009713.3-1646s21c1
Sequence:CCGGATTCCTGGGCATCCCATATTCCTCGAGGAATATGGGATGCCCAGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009713.3-2042s21c1
Sequence:CCGGAGTCATCTTCACTGCAGATAACTCGAGTTATCTGCAGTGAAGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009713.3-2492s21c1
Sequence:CCGGCCCACTGCTCTACGACTTATCCTCGAGGATAAGTCGTAGAGCAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009713.3-2165s21c1
Sequence:CCGGCTACTGGCCAGGTCACATTACCTCGAGGTAATGTGACCTGGCCAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009713.2-2999s1c1
Sequence:CCGGCCACCTTACCAGAAAGAGCTTCTCGAGAAGCTCTTTCTGGTAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009713.2-2321s1c1
Sequence:CCGGCCCACGGAAGTCTGTCTTCTTCTCGAGAAGAAGACAGACTTCCGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009713.2-1865s1c1
Sequence:CCGGCCGACCGTTCTTCCTGTACTACTCGAGTAGTACAGGAAGAACGGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009713.2-2027s1c1
Sequence:CCGGGCTGGAAGAGACACTAGTCATCTCGAGATGACTAGTGTCTCTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009713.2-1278s1c1
Sequence:CCGGCCTAACATCCTGCTGATCTTTCTCGAGAAAGATCAGCAGGATGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000487
ARSA MISSION shRNA Bacterial Glycerol Stock
arylsulfatase A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000487.4-1254s21c1
Sequence:CCGGGACCTGAGACCATGCGTATGTCTCGAGACATACGCATGGTCTCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000487.4-818s21c1
Sequence:CCGGCATCAGGGCTTCCATCGATTTCTCGAGAAATCGATGGAAGCCCTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000487.4-1113s21c1
Sequence:CCGGAGAGCTTTGCAGAGCGTTCAGCTCGAGCTGAACGCTCTGCAAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000487.3-436s1c1
Sequence:CCGGCCCAACATCGTGCTGATCTTTCTCGAGAAAGATCAGCACGATGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000487.3-1053s1c1
Sequence:CCGGCCACACCCACTACCCTCAGTTCTCGAGAACTGAGGGTAGTGGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000487.3-1260s1c1
Sequence:CCGGCGGTCTCTTGCGGTGTGGAAACTCGAGTTTCCACACCGCAAGAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000487.3-1491s1c1
Sequence:CCGGTCTCTTCTTCTACCCGTCCTACTCGAGTAGGACGGGTAGAAGAAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000487.3-543s1c1
Sequence:CCGGGCTGCGGTTCACAGACTTCTACTCGAGTAGAAGTCTGTGAACCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000487
ARSA MISSION shRNA shRNA Plasmid DNA
arylsulfatase A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000487.4-1254s21c1
Sequence:CCGGGACCTGAGACCATGCGTATGTCTCGAGACATACGCATGGTCTCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000487.4-818s21c1
Sequence:CCGGCATCAGGGCTTCCATCGATTTCTCGAGAAATCGATGGAAGCCCTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000487.4-1113s21c1
Sequence:CCGGAGAGCTTTGCAGAGCGTTCAGCTCGAGCTGAACGCTCTGCAAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000487.3-436s1c1
Sequence:CCGGCCCAACATCGTGCTGATCTTTCTCGAGAAAGATCAGCACGATGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000487.3-1053s1c1
Sequence:CCGGCCACACCCACTACCCTCAGTTCTCGAGAACTGAGGGTAGTGGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000487.3-1260s1c1
Sequence:CCGGCGGTCTCTTGCGGTGTGGAAACTCGAGTTTCCACACCGCAAGAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000487.3-1491s1c1
Sequence:CCGGTCTCTTCTTCTACCCGTCCTACTCGAGTAGGACGGGTAGAAGAAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000487.3-543s1c1
Sequence:CCGGGCTGCGGTTCACAGACTTCTACTCGAGTAGAAGTCTGTGAACCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000487
ARSA MISSION shRNA Lentiviral Transduction Particles
arylsulfatase A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000487.4-1254s21c1
Sequence:CCGGGACCTGAGACCATGCGTATGTCTCGAGACATACGCATGGTCTCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000487.4-818s21c1
Sequence:CCGGCATCAGGGCTTCCATCGATTTCTCGAGAAATCGATGGAAGCCCTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000487.4-1113s21c1
Sequence:CCGGAGAGCTTTGCAGAGCGTTCAGCTCGAGCTGAACGCTCTGCAAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000487.3-436s1c1
Sequence:CCGGCCCAACATCGTGCTGATCTTTCTCGAGAAAGATCAGCACGATGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000487.3-1053s1c1
Sequence:CCGGCCACACCCACTACCCTCAGTTCTCGAGAACTGAGGGTAGTGGGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000487.3-1260s1c1
Sequence:CCGGCGGTCTCTTGCGGTGTGGAAACTCGAGTTTCCACACCGCAAGAGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000487.3-1491s1c1
Sequence:CCGGTCTCTTCTTCTACCCGTCCTACTCGAGTAGGACGGGTAGAAGAAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000487.3-543s1c1
Sequence:CCGGGCTGCGGTTCACAGACTTCTACTCGAGTAGAAGTCTGTGAACCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)